refSNP ID: rs1058338 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_020731.3:c.*156C>T NT_006576.15:g.425105C>T Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1539783 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1058338 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1539783 LEE|764901 fwd/B C/T cgcagtctgctagtgtgtgtgtgcagcata gcaggagcctatcctgaattttgtaaaata 09/13/00 10/10/03 86 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1058338|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=86 GCTTTGCAGA GCTGTGCATG CGCAGTCTGC TAGTGTGTGT GTGCAGCATA Y GCAGGAGCCT ATCCTGAATT TTGTAAAATA TCCCAACAGT TCTTAAATGA   GeneView GeneView via analysis of contig annotation: AHRR aryl-hydrocarbon receptor repressor View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_006576->NM_020731 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_006576->NM_020731-> 425105 forward 2360 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1058338 maps exactly once on NCBI human chromosome 5 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 5 NW_001838923.2 1699850 423121 minus G alt_assembly_8 HuRef HuRef view 50 5 NT_006576.15 425105 488105 plus C ref_assembly reference reference view 50 5 NW_922496.1 421110 533182 plus C alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank AI472048 Hs.170760 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_020731.3 AB033060.1 BC151852.1 BC152406.1 UniGene Cluster ID 50823   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .