PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:6023 Links RH70954 Homo sapiens chromosome 15, locus SH3GL3 Pan troglodytes chromosome 15, locus SH3GL3 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Sus scrofa. Primer Information Forward primer: AATGACTTTTGTATGTGTGCTCTCT Reverse primer: TAACCAATGACTTTTAGGACAGGA PCR product size: 132 (bp), Homo sapiens GenBank Accession: X99664    Homo sapiens Name: RH70954 Also known as: X99664 Polymorphism info:   Cross References Gene GeneID: 6457   Symbol: SH3GL3   Description: SH3-domain GRB2-like 3   Position: 15q24 UniGene Hs.270055 SH3-domain GRB2-like 3 Mapping Information RH70954 Sequence Map: Chr 15|Celera Map Viewer   Position: 60299212-60299340 (bp)   RH70954 Sequence Map: Chr 15|HuRef Map Viewer   Position: 60550968-60551096 (bp)   RH70954 Sequence Map: Chr 15 Map Viewer   Position: 82078148-82078276 (bp)   X99664 NCBI RH Map: Chr 15 Map Viewer   Position: 575.2 (cR)   Lod score: 1.35   X99664 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 297.50 (cR3000)   Lod score: 3.00   Reference Interval: D15S115-D15S152 Electronic PCR results RefSeq mRNA (1) NM_003027.2 1665 .. 1796 (132 bp)     mRNA (5 of 7)[Show All Hits] X99664.1 1149 .. 1280 (132 bp)   AF036269.1 1152 .. 1283 (132 bp)   AF036270.1 1145 .. 1276 (132 bp)   AF036271.1 1665 .. 1796 (132 bp)   AL109775.1 694 .. 825 (132 bp)     Genomic (5 of 7)[Show All Hits] AC087738.13 72903 .. 73031 (129 bp)   CH003462.1 59762641 .. 59762772 (132 bp)   CH003510.1 63826696 .. 63826827 (132 bp)   CH471188.1 593323 .. 593451 (129 bp)   CM000266.1 60299212 .. 60299340 (129 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC015715.4 149063 .. 149194 (132 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC010673.7 91707 .. 91835 (129 bp)     ESTs (5 of 24)[Show All Hits] N49417.1 223 .. 354 (132 bp)   N66236.1 221 .. 352 (132 bp)   AI207911.1 185 .. 313 (129 bp)   AI333036.1 223 .. 354 (132 bp)   AI336437.1 231 .. 359 (129 bp)     Whole Genome Shotgun sequences (4) AADD01145274.1 11543 .. 11674 (132 bp)   AADC01122712.1 74181 .. 74312 (132 bp)   AADB02016802.1 76977 .. 77105 (129 bp)   ABBA01029442.1 158341 .. 158469 (129 bp)        Pan troglodytes Name: RH70954 Polymorphism info:   Cross References Gene GeneID: 453602   Symbol: SH3GL3   Description: SH3-domain GRB2-like 3   Position:   Mapping Information RH70954 Sequence Map: Chr 15 Map Viewer   Position: 81514243-81514374 (bp) Electronic PCR results RefSeq mRNA (5) XM_001161355.1 1562 .. 1693 (132 bp)   XM_001161312.1 1577 .. 1708 (132 bp)   XM_001161132.1 1083 .. 1214 (132 bp)   XM_510558.2 1665 .. 1796 (132 bp)   XM_001161217.1 1176 .. 1307 (132 bp)     Genomic (1) CM000329.1 81514243 .. 81514374 (132 bp)     Whole Genome Shotgun sequences (2) AADA01008786.1 10000 .. 10131 (132 bp)   AACZ02157122.1 11799 .. 11930 (132 bp)        Sus scrofa   Polymorphism info:   Cross References UniGene Ssc.28519 Transcribed locus, strongly similar to NP_003018.2 SH3-domain GRB2-like 3 [H... Electronic PCR results ESTs (1) EW297627.1 13 .. 143 (131 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement