Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL670771.6 and AL672285.8

AL670771.6 Mouse DNA sequence from clone RP23-256C8 on chromosome X Contains a novel gene (4932429P05Rik) and a pseudogene similar to part of splicing factor arginine/serine-rich 2 interacting protein (Sfrs2ip), complete sequence [htgs_phase3]

Length: 219,340 bp

AL672285.8 Mouse DNA sequence from clone RP23-45G5 on chromosome X Contains a novel gene (4930415L06Rik) and a novel pseudogene, complete sequence [htgs_phase3]

Length: 164,443 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 570
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  1 BAC and 2 Fosmid bridging clones.
  1 BAC and 2 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL670771.6 >217341  ttgtacctgataaaaaagaaagtgaggccttgaactgattgacacaggaaataactttct 217400 
AL672285.8 >1       ............................................................ 60     

AL670771.6 >217401  gagcaaaacggcattagcacagggactaagatcaataattttaaaatatgacctcatgaa 217460 
AL672285.8 >61      ............................................................ 120    

AL670771.6 >217461  gctgaaagtttctgtatgacaaagaacatcatcatttgggcaaagcaatgaattacagaa 217520 
AL672285.8 >121     ............................................................ 180    

AL670771.6 >217521  taggaaagattatttaaacagacaaaaagtattccattgcataaatataacatattttct 217580 
AL672285.8 >181     ............................................................ 240    

AL670771.6 >217581  ttatccatgaacacatttacagacatctggattagttccaattactggctattatggata 217640 
AL672285.8 >241     ............................................................ 300    

AL670771.6 >217641  gagcagcagtgaatatgtttgagcatatgattttgtggtaggataaagtattctctgagt 217700 
AL672285.8 >301     ............................................................ 360    

AL670771.6 >217701  atatgatcaagagtactatggttcaatattgaggtaagtccattcacatctttctaaaga 217760 
AL672285.8 >361     ............................................................ 420    

AL670771.6 >217761  atttccatattgatttccatagtagctataaatgacttcactcccaccagcagtggatga 217820 
AL672285.8 >421     ............................................................ 480    

AL670771.6 >217821  aagtctctcttcttccacatccttggcaatatgagctgtactttgtgttattgaagttgg 217880 
AL672285.8 >481     ............................................................ 540    

AL670771.6 >217881  atatttctgactagtataagatggaatagtaaagtactttttaaaatttccctgatgact 217940 
AL672285.8 >541     ............................................................ 600    

AL670771.6 >217941  aagatgttgaacatttctttgtttcctactcatttttattcctctattgagaatttgtgt 218000 
AL672285.8 >601     ............................................................ 660    

AL670771.6 >218001  gtatccatacctcatttttgttgcttttttccttgatgtccagttttattttttaagttc 218060 
AL672285.8 >661     ............................................................ 720    

AL670771.6 >218061  ctcatatattttagaaaattgccatctatcagaagtatagttgtggaggggaatggggga 218120 
AL672285.8 >721     ............................................................ 780    

AL670771.6 >218121  gtttaggattgggtgtggagaaggacaaaaaagagagctagatagtcatgaaaatgaata 218180 
AL672285.8 >781     ............................................................ 840    

AL670771.6 >218181  taaatctaaaaatgacagaagtgaggaagtaggtggcatctccaagatgagatagagacc 218240 
AL672285.8 >841     ............................................................ 900    

AL670771.6 >218241  tgagataagggtgacacccaaaaaacacttggggtgatcttatttgtgactcattgcatt 218300 
AL672285.8 >901     ............................................................ 960    

AL670771.6 >218301  ggcaatatgtctcctgaagaggccacttcctatgaccaggcaggaatcacagtggactaa 218360 
AL672285.8 >961     ............................................................ 1020   

AL670771.6 >218361  tagggacaccaatccacccacaaaactttcaaccctaaatttatcctgtcaataagagat 218420 
AL672285.8 >1021    ............................................................ 1080   

AL670771.6 >218421  acaggcacatgtaatagagcaaagccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 218480 
AL672285.8 >1081    ............................................................ 1140   

AL670771.6 >218481  aaaaaaaaaaaaaggaatggcaaacaaataaccagcccaactagagacctagttaatggg 218540 
AL672285.8 >1141    ............................................................ 1200   

AL670771.6 >218541  aaagcaccaatcccaaacactattaatggtactctgttatacttgcatacaggagcctag 218600 
AL672285.8 >1201    ............................................................ 1260   

AL670771.6 >218601  catggatattctctgagagggtctatctagcagctgacttagatacagatacgcaaagct 218660 
AL672285.8 >1261    ............................................................ 1320   

AL670771.6 >218661  aagcagcagatggagcttgaggactcttatggaagcataggaggaagaattacaggactg 218720 
AL672285.8 >1321    ............................................................ 1380   

AL670771.6 >218721  aaaggaactccacaggaagatcagcagagccatctaacctggataattttgactctcaga 218780 
AL672285.8 >1381    ............................................................ 1440   

AL670771.6 >218781  atatgaatcaatagccaaagaacacacacaggattgacctaggctttcccacacatatgg 218840 
AL672285.8 >1441    ............................................................ 1500   

AL670771.6 >218841  agaagatgggctgcttagtcttcatgtgggtcccaaacaactggcatggggactatccca 218900 
AL672285.8 >1501    ............................................................ 1560   

AL670771.6 >218901  aaagctgttgcctgtaggcaagatgttcacctagctgggctgccttgtctgaactcgatg 218960 
AL672285.8 >1561    ............................................................ 1620   

AL670771.6 >218961  tgaaatgaagtgcttagtctcatagagattgaagtgccaggttgtgggaatactctgggg 219020 
AL672285.8 >1621    ............................................................ 1680   

AL670771.6 >219021  gaaagtacatattcagaggagaaggacaggaggatgggagaaggactatgggagggggtg 219080 
AL672285.8 >1681    ............................................................ 1740   

AL670771.6 >219081  actgggaggggaaagtaagcagcacataaattgaataagtaaaattttaaattaaattaa 219140 
AL672285.8 >1741    ............................................................ 1800   

AL670771.6 >219141  attaagaagaaaacaaaaagaaatgtttaattttctccacagatgctacccaccaatgtc 219200 
AL672285.8 >1801    ............................................................ 1860   

AL670771.6 >219201  aaaaaatatctgataaacaacttaaataaacctttaatccctaagaaagcactctttaaa 219260 
AL672285.8 >1861    ............................................................ 1920   

AL670771.6 >219261  tgtatatcaacaaaaccaagtcaaacaaaaacaaacaaacaaacaaacaaaacaacagtt 219320 
AL672285.8 >1921    ............................................................ 1980   

AL670771.6 >219321  ccagatttagtgcagaattc 219340 
AL672285.8 >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	219340	2001	+	+	chenhc	Taxid 10090 chrom X Reference assembly	2008-11-20 17:02:23.740

Events

Id	Type	Date	Whodid	Comment
1109	ImportOldDb	09/02/2005 08:42:00	f_old_db
1110	ReSetShortOvlp	09/04/2008 10:31:48	dbo
179705	CreateSwitchPt	11/20/2008 17:02:23	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-157A15	AL670771.6	99.03%	pos 109365 (R-)
C3H-157A15	AL670771.6	99.74%	pos 109380 (R-)
C3H-175A11	AL670771.6	99.7%	pos 75630 (R+)	AL670771.6	99.44%	pos 198247 (F-)
C3H-70E15				AL670771.6	99.76%	pos 48058 (F-)
C3H-98G21				AL672285.8	99.23%	pos 157759 (F+)
CH29-147F15				AL672285.8	99.75%	pos 145101 (F+)
CH29-23O9				AL670771.6	99.78%	pos 153201 (F+)
CH29-25K9				AL672285.8	99.74%	pos 73029 (F+)
CH29-547F4	AL670771.6	99.63%	pos 219311 (R-)	AL670771.6	99.71%	pos 42177 (F+)
CH29-547F4	AL672285.8	99.63%	pos 1971 (R-)
CH29-561E9	AL670771.6	100%	pos 94785 (R-)
CH29-595B4				AL672285.8	99.75%	pos 159753 (F-)
CH29-94H6				AL670771.6	99.21%	pos 108116 (F-)
RP23-127G11				AL670771.6	99.62%	pos 64802 (F-)
RP23-300N20	AL672285.8	99%	pos 54349 (R+)
RP24-184K19	AL670771.6	99.2%	pos 93476 (R+)
RP24-389L1	AL670771.6	99.69%	pos 88547 (R-)
RP24-62J1	AL672285.8	99.41%	pos 120290 (R+)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1523L13	AL670771.6	99.66%	pos 175900 (R+)	AL670771.6	100%	pos 213922 (F-)
WI1-1637P10	AL672285.8	100%	pos 18606 (R-)	AL670771.6	100%	pos 195273 (F+)
WI1-1639O8	AL670771.6	99.78%	pos 98537 (R-)	AL670771.6	99.63%	pos 59229 (F+)
WI1-1810M6				AL672285.8	99.51%	pos 70188 (F+)
WI1-1867N17	AL672285.8	99.82%	pos 105309 (R-)	AL672285.8	99.71%	pos 66000 (F+)
WI1-1969I24	AL672285.8	99.76%	pos 64266 (R-)
WI1-2063M17	AL670771.6	100%	pos 82251 (R+)	AL670771.6	100%	pos 121775 (F-)
WI1-2348H19	AL670771.6	99.8%	pos 6845 (R-)
WI1-2419L15				AL670771.6	100%	pos 9190 (F-)
WI1-2506B5	AL670771.6	100%	pos 160995 (R-)	AL670771.6	99.83%	pos 128520 (F+)
WI1-2649I13	AL670771.6	99.77%	pos 56651 (R-)	AL670771.6	99.5%	pos 17944 (F+)
WI1-2685L1	AL672285.8	100%	pos 93027 (R-)	AL672285.8	100%	pos 53482 (F+)
WI1-2794K10	AL670771.6	99.82%	pos 138283 (R-)	AL670771.6	99.81%	pos 101966 (F+)
WI1-2804G10	AL670771.6	100%	pos 213629 (R-)	AL670771.6	100%	pos 175073 (F+)
WI1-290G14	AL670771.6	99.64%	pos 49246 (R-)	AL670771.6	100%	pos 9187 (F+)
WI1-422G8	AL672285.8	99.69%	pos 45996 (R-)
WI1-448P10	AL672285.8	100%	pos 45970 (R-)
WI1-486G8	AL670771.6	99.77%	pos 212755 (R+)	AL672285.8	100%	pos 37293 (F-)
WI1-590M8	AL670771.6	99.85%	pos 159437 (R+)	AL670771.6	99.86%	pos 198811 (F-)
WI1-610O22	AL672285.8	100%	pos 17087 (R-)
WI1-61K22	AL672285.8	99.84%	pos 69128 (R+)	AL672285.8	100%	pos 107682 (F-)
WI1-630F2	AL670771.6	100%	pos 117081 (R+)	AL670771.6	100%	pos 162352 (F-)
WI1-855E23	AL670771.6	99.83%	pos 101112 (R+)	AL670771.6	100%	pos 138944 (F-)
WI1-855E23	AL670771.6	100%	pos 101115 (R+)	AL670771.6	100%	pos 138987 (F-)
WI1-90K8	AL670771.6	100%	pos 134787 (R-)	AL670771.6	99.82%	pos 93640 (F+)
WI1-971M21				AL670771.6	99.66%	pos 33879 (F+)
WI1-975C11	AL672285.8	99.05%	pos 74416 (R-)	AL672285.8	99.48%	pos 35159 (F+)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL670771.6 and AL672285.8

Alignment Summary

Alignment 1 of 1