PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:60380 Links WI-15402 Homo sapiens chromosome 17, locus WIPF2 Pan troglodytes chromosome 17, locus LOC455039 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TAAATTTTTAAGCTAATTTTCCCCA Reverse primer: TACAACTGTTGCTATGTGTAGAGGG PCR product size: 103 (bp), Homo sapiens GenBank Accession: H11441    Homo sapiens Name: WI-15402 Also known as: EST271355 Polymorphism info:   Cross References Gene GeneID: 147179   Symbol: WIPF2   Description: WAS/WASL interacting protein family, member 2   Position: 17q21.2 UniGene Hs.421622 WAS/WASL interacting protein family, member 2 Mapping Information WI-15402 Sequence Map: Chr 17|HuRef Map Viewer   Position: 34229226-34229328 (bp)   WI-15402 Sequence Map: Chr 17|Celera Map Viewer   Position: 35096085-35096187 (bp)   WI-15402 Sequence Map: Chr 17 Map Viewer   Position: 35689469-35689571 (bp)   WI-15402 NCBI RH Map: Chr 17 Map Viewer   Position: 506 (cR)   Lod score: 1.14   WI-15402 Whitehead-RH Map: Chr 17 Map Viewer   Position: 330.7 (cR3000)   Lod score: P0.62   WI-15402 GeneMap99-GB4 Map: Chr 17 Map Viewer   Position: 309.33 (cR3000)   Lod score: 0.72   Reference Interval: D17S933-D17S800 Electronic PCR results RefSeq mRNA (1) NM_133264.4 3029 .. 3131 (103 bp)     mRNA (5) U90911.1 1452 .. 1554 (103 bp)   AK026913.1 2477 .. 2579 (103 bp)   AK055057.1 2246 .. 2348 (103 bp)   BC043408.1 1986 .. 2088 (103 bp)   BC065551.1 2966 .. 3068 (103 bp)     Genomic (5 of 7)[Show All Hits] AC080112.15 143905 .. 144007 (103 bp)   CH003464.1 35946050 .. 35946152 (103 bp)   CH003512.1 39056642 .. 39056744 (103 bp)   CH471152.1 1967276 .. 1967378 (103 bp)   CM000268.1 35096085 .. 35096187 (103 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC015851.6 10783 .. 10885 (103 bp)     ESTs (5 of 60)[Show All Hits] F02943.1 57 .. 159 (103 bp)   F10937.1 57 .. 159 (103 bp)   T91033.1 59 .. 161 (103 bp)   R36889.1 67 .. 169 (103 bp)   H11441.1 68 .. 170 (103 bp)     Whole Genome Shotgun sequences (4) AADD01153779.1 9728 .. 9830 (103 bp)   AADC01130394.1 1989 .. 2091 (103 bp)   AADB02018413.1 15048 .. 15150 (103 bp)   ABBA01031833.1 12266 .. 12368 (103 bp)        Pan troglodytes Name: WI-15402 Polymorphism info:   Cross References Gene GeneID: 455039   Symbol: LOC455039   Description: similar to WICH   Position:   Mapping Information WI-15402 Sequence Map: Chr 17 Map Viewer   Position: 17252116-17252218 (bp) Electronic PCR results RefSeq mRNA (1) XM_511807.2 2217 .. 2319 (103 bp)     Genomic (1) CM000331.1 17252116 .. 17252218 (103 bp)     Whole Genome Shotgun sequences (2) AADA01266877.1 11742 .. 11844 (103 bp)   AACZ02169245.1 11851 .. 11953 (103 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement