PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:70016 Links D9S162 Primer Information Forward primer: TGACCAGTTAAGGTTCCTTTC Reverse primer: ATTCCCACAACAAATCTCCT PCR product size: 181 (bp), Homo sapiens GenBank Accession: Z16600    Homo sapiens Name: D9S162 Also known as: AFM115yb4 SHGC-730 stSG562 Polymorphism info:   Cross References Gene GeneID: 25769   Symbol: SLC24A2   Description: solute carrier family 24 (sodium/potassium/calcium exchanger), member 2   Position: 9p22-p13 Mapping Information D9S162 Sequence Map: Chr 9|Celera Map Viewer   Position: 19605777-19605957 (bp)   D9S162 Sequence Map: Chr 9|HuRef Map Viewer   Position: 19642113-19642295 (bp)   D9S162 Sequence Map: Chr 9 Map Viewer   Position: 19669808-19669988 (bp)   SHGC-730 NCBI RH Map: Chr 9 Map Viewer   Position: 246.9 (cR)   Lod score: 1.44   SHGC-730 TNG Map: Chr 9 Map Viewer   Position: 9911 (cR50000)   Lod score: 3.3   Reference Interval: 23   SHGC-730 Stanford-G3 Map: Chr 9 Map Viewer   Position: 741 (cR10000)   Lod score: F   Reference Interval: 2   AFM115yb4 GeneMap99-G3 Map: Chr 9 Map Viewer   Position: 741 (cR10000)   Lod score: F   Reference Interval: D9S162-D9S171   AFM115yb4 GeneMap99-GB4 Map: Chr 9 Map Viewer   Position: 65.95 (cR3000)   Lod score: F   Reference Interval: D9S162-D9S171 Electronic PCR results Genomic (5 of 9)[Show All Hits] Z16600.1 33 .. 213 (181 bp)   AL133281.12 83248 .. 83428 (181 bp)   CH003456.1 19698361 .. 19698543 (183 bp)   CH003504.1 20959241 .. 20959423 (183 bp)   AB133448.1 170 .. 350 (181 bp)     Whole Genome Shotgun sequences (4) AADD01098357.1 40661 .. 40843 (183 bp)   AADC01081736.1 244946 .. 245128 (183 bp)   AADB02012469.1 283350 .. 283530 (181 bp)   ABBA01065194.1 90045 .. 90227 (183 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement