| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
|---|---|---|---|---|---|---|---|---|---|---|
| 145559 | hypothetical | BPSL0792 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc0566 or rs04899 SWALL:Q8Y1X1 (EMBL:AL646060) (65 aa) fasta scores: E(): 6.7e-12, 57.62% id in 59 aa, and to Neisseria meningitidis hypothetical protein nmb0542 SWALL:Q9K0P3 (EMBL:AE002410) (67 aa) fasta scores: E(): 4.1e-07, 44.06% id in 59 aa | genbank | 52208845 | CAH34784.1 | 65 | 920164 | 920361 | |
| 145560 | ilvE | hypothetical | BPSL0793 | putative branched-chain amino acid aminotransferase IlvE Similar to Escherichia coli, and Escherichia coli O157:H7 branched-chain amino acid aminotransferase IlvE SWALL:ILVE_ECOLI (SWALL:P00510) (308 aa) fasta scores: E(): 3e-52, 47% id in 300 aa, and to Ralstonia solanacearum probable branched-chain amino acid aminotransferase protein ilvE1 or rsc0567 or rs04898 SWALL:Q8Y1X0 (EMBL:AL646060) (309 aa) fasta scores: E(): 3.1e-94, 77.45% id in 306 aa | genbank | 52208846 | CAH34785.1 | 307 | 920427 | 921350 |
| 145561 | hypothetical | BPSL0794 | AzlC family protein Similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0568 or rs04897 SWALL:Q8Y1W9 (EMBL:AL646060) (265 aa) fasta scores: E(): 2.7e-49, 59.18% id in 245 aa. Weakly similar to Ralstonia solanacearum hypothetical transmembrane protein rsc0513 or rs04992 SWALL:Q8Y223 (EMBL:AL646059) (242 aa) fasta scores: E(): 3.5e-15, 28.2% id in 234 aa | genbank | 52208847 | CAH34786.1 | 249 | 921572 | 922321 | |
| 145562 | hypothetical | BPSL0795 | putative membrane protein Similar to Ralstonia solanacearum probable transmembrane protein rsc0569 or rs04896 SWALL:Q8Y1W8 (EMBL:AL646060) (107 aa) fasta scores: E(): 8.6e-16, 50.47% id in 105 aa | genbank | 52208848 | CAH34787.1 | 107 | 922318 | 922641 | |
| 145563 | pgk | hypothetical | BPSL0796 | phosphoglycerate kinase Similar to Escherichia coli phosphoglycerate kinase Pgk or b2926 SWALL:PGK_ECOLI (SWALL:P11665) (386 aa) fasta scores: E(): 1.8e-80, 63.7% id in 394 aa, and to Ralstonia solanacearum phosphoglycerate kinase Pgk or rsc0571 or rs04894 SWALL:Q8Y1W6 (EMBL:AL646060) (419 aa) fasta scores: E(): 1.7e-115, 85.64% id in 397 aa | genbank | 52208849 | CAH34788.1 | 397 | 922908 | 924101 |
| 145564 | pykA | hypothetical | BPSL0797 | putative pyruvate kinase II protein Similar to Pseudomonas hydrogenothermophila pyruvate kinase Pyk SWALL:Q9LBF0 (EMBL:AB042618) (473 aa) fasta scores: E(): 5.5e-91, 58.82% id in 476 aa, and to Ralstonia solanacearum probable pyruvate kinase II protein rsc0572 or rs04893 SWALL:Q8Y1W5 (EMBL:AL646060) (479 aa) fasta scores: E(): 2.9e-131, 78.49% id in 479 aa | genbank | 52208850 | CAH34789.1 | 478 | 924436 | 925872 |
| 145565 | cbbA | hypothetical | BPSL0798 | fructose-bisphosphate aldolase Similar to Xanthobacter flavus fructose-bisphosphate aldolase CbbA SWALL:ALF_XANFL (SWALL:Q56815) (354 aa) fasta scores: E(): 5.9e-95, 71.67% id in 353 aa, and to Ralstonia solanacearum probable fructose-bisphosphate aldolase protein FbaA or rsc0573 or rs04892 SWALL:Q8Y1W4 (EMBL:AL646060) (354 aa) fasta scores: E(): 4.3e-101, 75.42% id in 354 aa | genbank | 52208851 | CAH34790.1 | 354 | 926153 | 927217 |
| 145566 | purC | hypothetical | BPSL0799 | 5'-phosphoribosyl-4-N-succinocarboxamide-5-amino imidazole synthetase Similar to Corynebacterium ammoniagenes 5'-phosphoribosyl-4-N-succinocarboxamide-5-amino imidazole synthetase PurC SWALL:Q9RHX2 (EMBL:AB003161) (295 aa) fasta scores: E(): 2.6e-53, 52.66% id in 281 aa, and to Ralstonia solanacearum phosphoribosylaminoimidazole-succinocarboxamide synthase rsc0574 or rs04891 SWALL:Q8Y1W3 (EMBL:AL646060) (302 aa) fasta scores: E(): 9.8e-93, 76.92% id in 299 aa | genbank | 52208852 | CAH34791.1 | 296 | 927407 | 928297 |
| 145567 | purE | hypothetical | BPSL0800 | phosphoribosylaminoimidazole carboxylase catalytic subunit Similar to Bacillus subtilis phosphoribosylaminoimidazole carboxylase catalytic subunit PurE SWALL:PUR6_BACSU (SWALL:P12044) (162 aa) fasta scores: E(): 1.2e-32, 67.58% id in 145 aa, and to Ralstonia solanacearum probable phosphoribosylaminoimidazole carboxylase catalytic subunit protein rsc0575 or rs04890 SWALL:Q8Y1W2 (EMBL:AL646060) (169 aa) fasta scores: E(): 6.3e-42, 74.07% id in 162 aa | genbank | 52208853 | CAH34792.1 | 172 | 928333 | 928851 |
| 145568 | purK | hypothetical | BPSL0801 | phosphoribosylaminoimidazole carboxylase ATPase subunit Similar to Brucella melitensis phosphoribosylaminoimidazole carboxylase ATPase subunit PurK SWALL:PURK_BRUME (SWALL:P52559) (362 aa) fasta scores: E(): 5.8e-49, 46.68% id in 362 aa, and to Ralstonia solanacearum probable phosphoribosylaminoimidazole carboxylase ATPase subunit protein rsc0576 or rs04889 SWALL:Q8Y1W1 (EMBL:AL646060) (413 aa) fasta scores: E(): 1e-83, 61.29% id in 385 aa | genbank | 52208854 | CAH34793.1 | 398 | 928931 | 930127 |
| 145569 | hypothetical | BPSL0802 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc0577 or rs04888 SWALL:Q8Y1W0 (EMBL:AL646060) (336 aa) fasta scores: E(): 3e-68, 64.16% id in 346 aa, and to Thermomonospora fusca hypothetical protein SWALL:Q9XCD2 (EMBL:AF144563) (335 aa) fasta scores: E(): 4.4e-41, 49.24% id in 331 aa | genbank | 52208855 | CAH34794.1 | 341 | 930139 | 931164 | |
| 145570 | hypothetical | BPSL0803 | putative acylhydrolase Similar to Ralstonia solanacearum putative lipase / esterase protein rsc0580 or rs04885 SWALL:Q8Y1V9 (EMBL:AL646060) (347 aa) fasta scores: E(): 0.00034, 44.07% id in 363 aa. C-terminal region is similar to the N-terminal region of Acidiphilium sp. AIU409 esterase estA SWALL:Q9WXJ8 (EMBL:AB026254) (627 aa) fasta scores: E(): 0.00055, 29.79% id in 339 aa | genbank | 52208856 | CAH34795.1 | 379 | 931480 | 932619 | |
| 145571 | hypothetical | BPSL0804 | putative membrane protein Similar to Caulobacter crescentus hypothetical protein cc1444 SWALL:Q9A8B0 (EMBL:AE005819) (300 aa) fasta scores: E(): 6e-41, 40.79% id in 277 aa, and to Rhizobium loti hypothetical protein mll1065 SWALL:Q98LE0 (EMBL:AP002996) (317 aa) fasta scores: E(): 7.1e-40, 43.38% id in 272 aa Upstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3 | genbank | 52208857 | CAH34796.1 | 305 | 932724 | 933641 | |
| 145572 | hypothetical | BPSL0805 | family S13 unassigned peptidase Weakly similar to Escherichia coli penicillin-binding protein 4 precursor DacB or b3182 SWALL:PBP4_ECOLI (SWALL:P24228) (477 aa) fasta scores: E(): 2.3e-23, 26.06% id in 422 aa. Similar to Ralstonia solanacearum probable D-alanyl-D-alanine carboxypeptidase signal peptide protein rsc0584 or rs04879 SWALL:Q8Y1V5 (EMBL:AL646060) (514 aa) fasta scores: E(): 1.3e-86, 54.25% id in 494 aa Downstream repeat region (cggcgagggaaacggcgagggaaacggcgagggaaa)3 | genbank | 52208858 | CAH34797.1 | 483 | 934041 | 935492 | |
| 145573 | hypothetical | BPSL0806 | response regulator protein Two-component regulatory system family, response regulator protein. Similar to Escherichia coli transcriptional regulatory protein QseB SWALL:QSEB_ECOLI (SWALL:P52076) (219 aa) fasta scores: E(): 9.3e-39, 53.27% id in 214 aa, and to Ralstonia solanacearum probable response regulator transcription regulator protein rsc3404 or rs01713 SWALL:Q8XTZ1 (EMBL:AL646075) (221 aa) fasta scores: E(): 2.9e-46, 60.73% id in 219 aa | genbank | 52208859 | CAH34798.1 | 220 | 935760 | 936422 | |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145574 | hypothetical | BPSL0807 | sensor kinase protein Similar to Escherichia coli sensor protein QseC SWALL:QSEC_ECOLI (SWALL:P40719) (449 aa) fasta scores: E(): 4.1e-30, 31.04% id in 451 aa, and to Ralstonia solanacearum probable transmembrane two-component sensor kinase transcription regulator protein rsp1553 or rs02109 SWALL:Q8XPT4 (EMBL:AL646085) (438 aa) fasta scores: E(): 3e-69, 50.22% id in 438 aa | genbank | 52208860 | CAH34799.1 | 438 | 936426 | 937742 | |
| 145575 | hypothetical | BPSL0808 | subfamily S1C unassigned peptidase Similar to Pseudomonas aeruginosa serine protease MucD or pa0766 SWALL:Q57155 (EMBL:U49151) (474 aa) fasta scores: E(): 1.8e-70, 47.43% id in 468 aa, and to Ralstonia solanacearum probable protease signal peptide protein rsp1552 or rs02108 SWALL:Q8XPT5 (EMBL:AL646085) (490 aa) fasta scores: E(): 2.4e-89, 58.99% id in 478 aa | genbank | 52208861 | CAH34800.1 | 472 | 938273 | 939691 | |
| 145576 | hypothetical | BPSL0809 | putative exported protein Similar to Ralstonia solanacearum putative signal peptide protein rsc1315 or rs02837 SWALL:Q8XZT0 (EMBL:AL646063) (141 aa) fasta scores: E(): 3.6e-06, 33.57% id in 137 aa | genbank | 52208862 | CAH34801.1 | 140 | 939851 | 940273 | |
| 145577 | hypothetical | BPSL0810 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc0235 or rs00667 SWALL:Q8Y2U7 (EMBL:AL646058) (118 aa) fasta scores: E(): 4.1e-11, 40.9% id in 110 aa, and to Rhizobium meliloti hypothetical protein rb0957 rb0957 or smb21379 SWALL:Q92UX8 (EMBL:AL603645) (124 aa) fasta scores: E(): 7.2e-10, 39.28% id in 112 aa | genbank | 52208863 | CAH34802.1 | 121 | 940401 | 940766 | |
| 145578 | hypothetical | BPSL0811 | putative membrane protein Hits of low significance from the databases. Weakly similar to Ralstonia solanacearum probable transmembrane protein rsc1464 or rs03843 SWALL:Q8XZD7 (EMBL:AL646064) (213 aa) fasta scores: E(): 0.0012, 30.25% id in 238 aa | genbank | 52208864 | CAH34803.1 | 242 | 940794 | 941522 | |
| 145579 | bpeR | hypothetical | BPSL0812 | TetR family regulatory protein Similar to Escherichia coli potential acrAB operon repressor AcrR SWALL:ACRR_ECOLI (SWALL:P34000) (215 aa) fasta scores: E(): 1.2e-22, 38.75% id in 209 aa, and to Ralstonia solanacearum putative acrAB operon repressor transcription regulator protein rsc0012 or rs01834 SWALL:Q8Y3G8 (EMBL:AL646057) (219 aa) fasta scores: E(): 6e-34, 47.84% id in 209 aa | genbank | 52208865 | CAH34804.1 | 211 | 941844 | 942479 |
| 145580 | bpeA | hypothetical | BPSL0814 | putative RND family acriflavine resistance protein A precursor Similar to Escherichia coli, and Escherichia coli O157:H7 acriflavine resistance protein A precursor acrA or MtcA or Lir SWALL:ACRA_ECOLI (SWALL:P31223) (397 aa) fasta scores: E(): 5.5e-60, 53.76% id in 385 aa, and to Ralstonia solanacearum probable acriflavin resistance lipoprotein A precursor rsc0011 or rs01833 SWALL:Q8Y3G9 (EMBL:AL646057) (398 aa) fasta scores: E(): 6.6e-61, 55.22% id in 402 aa | genbank | 52208866 | CAH34805.1 | 420 | 942889 | 944151 |
| 145581 | bpeB | hypothetical | BPSL0815 | putative RND family acriflavine resistance protein Similar to Escherichia coli acriflavine resistance protein B AcrB or AcrE or b0462 SWALL:ACRB_ECOLI (SWALL:P31224) (1049 aa) fasta scores: E(): 0, 66.63% id in 1049 aa, and to Klebsiella pneumoniae AcrB protein SWALL:Q93K40 (EMBL:AJ318073) (1048 aa) fasta scores: E(): 0, 66.79% id in 1048 aa | genbank | 52208867 | CAH34806.1 | 1066 | 944167 | 947367 |
| 145582 | oprB | hypothetical | BPSL0816 | outer membrane efflux protein Similar to Pseudomonas aeruginosa outer membrane protein OprM precursor pa0427 SWALL:OPRM_PSEAE (SWALL:Q51487) (485 aa) fasta scores: E(): 4.1e-85, 55.67% id in 476 aa, and to Xanthomonas axonopodis outer membrane protein xac2842 SWALL:AAM37687 (EMBL:AE011925) (503 aa) fasta scores: E(): 5.8e-84, 53.72% id in 497 aa | genbank | 52208868 | CAH34807.1 | 514 | 947371 | 948915 |
| 145583 | hypothetical | BPSL0817 | putative permease protein Similar to Bacillus subtilis xanthine permease PbuX SWALL:PBUX_BACSU (SWALL:P42086) (438 aa) fasta scores: E(): 3.3e-72, 48.67% id in 415 aa, and to Escherichia coli putative purine permease YgfU or b2888 SWALL:YGFU_ECOLI (SWALL:Q46821) (482 aa) fasta scores: E(): 9.1e-97, 59.03% id in 437 aa | genbank | 52208869 | CAH34808.1 | 481 | 949498 | 950943 | |
| 145584 | hypothetical | BPSL0818 | putative sugar kinase protein Similar to Escherichia coli xylulose kinase XylB or b3564 SWALL:XYLB_ECOLI (SWALL:P09099) (484 aa) fasta scores: E(): 2.8e-24, 34.3% id in 481 aa, and to Rhizobium meliloti putative sugar kinase protein r02569 or smc02341 SWALL:Q92MP4 (EMBL:AL591791) (477 aa) fasta scores: E(): 2.7e-37, 41.5% id in 477 aa | genbank | 52208870 | CAH34809.1 | 474 | 951272 | 952696 | |
| 145585 | hypothetical | BPSL0819 | AraC family transcriptional regulator Similar to Streptomyces griseus A-factor-responsive transcriptional activator AdpA SWALL:Q9S166 (EMBL:AB023785) (405 aa) fasta scores: E(): 2.1e-30, 36.33% id in 322 aa, and to Streptomyces coelicolor putative transcriptional regulator sco6746 or sc5f2a.29 SWALL:Q9X7Q2 (EMBL:AL049587) (325 aa) fasta scores: E(): 2.9e-43, 41.94% id in 329 aa Alternative start site at codon 33 upstream repeat region (ggcgc)3 | genbank | 52208871 | CAH34810.1 | 344 | 952965 | 953999 | |
| 145586 | flhA | hypothetical | BPSL0820 | glutathione-dependent formaldehyde dehydrogenase Similar to Paracoccus denitrificans glutathione-dependent formaldehyde dehydrogenase FlhA SWALL:FADH_PARDE (SWALL:P45382) (375 aa) fasta scores: E(): 1e-108, 75.2% id in 375 aa, and to Ralstonia solanacearum probable bifunctional: glutathione-dependent formaldehyde dehydrogenase and alcohol dehydrogenase class III oxidoreductase protein AdhC1 or rsp0069 or rs02044 SWALL:Q8XTN7 (EMBL:AL646076) (368 aa) fasta scores: E(): 4e-128, 88.04% id in 368 aa Upstream repeat region (ggcgc)3 | genbank | 52208872 | CAH34811.1 | 368 | 954204 | 955310 |
| 145587 | fghA | hypothetical | BPSL0821 | putative S-formylglutathione hydrolase Similar to Paracoccus denitrificans S-formylglutathione hydrolase FghA SWALL:Q51671 (EMBL:U34346) (279 aa) fasta scores: E(): 5.9e-55, 52.29% id in 283 aa, and to Ralstonia solanacearum probable hydrolase oxidoreductase protein rsc0604 or rs04840 SWALL:Q8Y1T5 (EMBL:AL646060) (289 aa) fasta scores: E(): 2.9e-77, 69.03% id in 281 aa | genbank | 52208873 | CAH34812.1 | 286 | 955324 | 956184 |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145588 | hypothetical | BPSL0822 | putative ABC transporter permease component Similar to Mycobacterium leprae putative ABC-transporter transmembrane protein ml0335 SWALL:Q9CCW1 (EMBL:AL583918) (286 aa) fasta scores: E(): 6.6e-22, 35.63% id in 261 aa, and to Thermoanaerobacter tengcongensis ABC-type Mn2+/Zn2+ transport systems, permease components znuB or tte0361 SWALL:Q8RCQ5 (EMBL:AE013009) (263 aa) fasta scores: E(): 2.3e-20, 32.03% id in 256 aa | genbank | 52208874 | CAH34813.1 | 263 | 956329 | 957120 | |
| 145589 | hypothetical | BPSL0823 | putative ABC transporter ATP-binding component Similar to Mycobacterium leprae putative ABC-tranporter ATP-binding protein ml0336 SWALL:Q9CCW0 (EMBL:AL583918) (275 aa) fasta scores: E(): 4.4e-25, 43.6% id in 250 aa, and to Pyrococcus horikoshii hypothetical protein ph1653 SWALL:O59348 (EMBL:AP000006) (260 aa) fasta scores: E(): 1.1e-19, 33.2% id in 256 aa | genbank | 52208875 | CAH34814.1 | 290 | 957113 | 957985 | |
| 145590 | hypothetical | BPSL0824 | putative periplasmic solute-binding protein Similar to Yersinia pestis periplasmic chelated iron-binding protein YfeA or ypo2439 or y1897 SWALL:YFEA_YERPE (SWALL:Q56952) (311 aa) fasta scores: E(): 3.9e-08, 31.05% id in 219 aa, and to Mycobacterium tuberculosis hypothetical protein rv2059 or mtcy63a.01c or mt2119 SWALL:O07257 (EMBL:Z97984) (511 aa) fasta scores: E(): 2.2e-19, 34.41% id in 247 aa | genbank | 52208876 | CAH34815.1 | 291 | 958008 | 958883 | |
| 145591 | hypothetical | BPSL0825 | putative Fur family transcriptional regulator Similar to Escherichia coli zinc uptake regulation protein Zur or b4046 SWALL:ZUR_ECOLI (SWALL:P32692) (171 aa) fasta scores: E(): 2.7e-12, 33.57% id in 137 aa, and to Pseudomonas aeruginosa transcriptional regulator Np20 or pa5499 SWALL:Q9HT74 (EMBL:AE004962) (167 aa) fasta scores: E(): 6e-21, 42.17% id in 147 aa. Possible alternative translational start sites | genbank | 52208877 | CAH34816.1 | 154 | 959141 | 959605 | |
| 145592 | hypothetical | BPSL0826 | sorbitol dehydrogenase Similar to Rhodobacter sphaeroides sorbitol dehydrogenase PolS or SmoS SWALL:DHSO_RHOSH (SWALL:Q59787) (256 aa) fasta scores: E(): 8e-54, 60.23% id in 259 aa, and to Ralstonia solanacearum putative sorbitol dehydrogenase rsc2147 or rs01456 SWALL:Q8XXG7 (EMBL:AL646068) (256 aa) fasta scores: E(): 1e-84, 87.5% id in 256 aa | genbank | 52208878 | CAH34817.1 | 258 | 959899 | 960675 | |
| 145593 | scrK | hypothetical | BPSL0827 | putative fructokinase Similar to Klebsiella pneumoniae fructokinase ScrK SWALL:SCRK_KLEPN (SWALL:P26420) (307 aa) fasta scores: E(): 9e-17, 33.91% id in 286 aa, and to Ralstonia solanacearum probable fructokinase protein CscK or rsc2146 or rs01457 SWALL:Q8XXG8 (EMBL:AL646068) (318 aa) fasta scores: E(): 3.1e-86, 74.52% id in 318 aa, and to Rhizobium loti fructokinase mll7216 SWALL:Q986T6 (EMBL:AP003011) (317 aa) fasta scores: E(): 1.6e-41, 42.81% id in 320 aa | genbank | 52208879 | CAH34818.1 | 318 | 960680 | 961636 |
| 145594 | hypothetical | BPSL0828 | putative tagatose 6-phosphate kinase protein Similar to Escherichia coli putative tagatose 6-phosphate kinase agaZ or KbaZ or b3132 SWALL:AGAZ_ECOLI (SWALL:P42903) (426 aa) fasta scores: E(): 5.8e-30, 47.4% id in 481 aa, and to Ralstonia solanacearum putative tagatose 6-phosphate kinase protein rsc2145 or rs01458 SWALL:Q8XXG9 (EMBL:AL646068) (451 aa) fasta scores: E(): 1.7e-61, 65.85% id in 495 aa. Possible alternative translational start site | genbank | 52208880 | CAH34819.1 | 498 | 961624 | 963120 | |
| 145595 | hypothetical | BPSL0829 | putative periplasmic ABC transporter substrate-binding component Similar to Ralstonia solanacearum probable sugar-binding periplasmic signal peptide protein rsc2144 or rs01459 SWALL:Q8XXH0 (EMBL:AL646068) (441 aa) fasta scores: E(): 6.6e-158, 89.14% id in 442 aa, and to Agrobacterium tumefaciens ABC transporter, substrate binding protein atu3165 or agr_l_3289 SWALL:Q8UB52 (EMBL:AE009246) (450 aa) fasta scores: E(): 2.2e-105, 61.15% id in 417 aa | genbank | 52208881 | CAH34820.1 | 442 | 963171 | 964499 | |
| 145596 | hypothetical | BPSL0830 | putative transmembrane ABC transporter protein Similar to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc2143 or rs01460 SWALL:Q8XXH1 (EMBL:AL646068) (317 aa) fasta scores: E(): 1.5e-103, 84.12% id in 315 aa, and to Pseudomonas aeruginosa probable binding-protein-dependent maltose/mannitol transport protein pa2339 SWALL:Q9I1D9 (EMBL:AE004660) (310 aa) fasta scores: E(): 2.1e-70, 61.67% id in 287 aa, and to Rhodobacter capsulatus maltose transport inner membrane protein SWALL:O68115 (EMBL:AF010496) (290 aa) fasta scores: E(): 1.6e-69, 62.5% id in 280 aa | genbank | 52208882 | CAH34821.1 | 314 | 964607 | 965551 | |
| 145597 | hypothetical | BPSL0831 | putative ABC transporter permease protein Similar to Ralstonia solanacearum probable transmembrane ABC transporter protein rsc2142 or rs01461 SWALL:Q8XXH2 (EMBL:AL646068) (286 aa) fasta scores: E(): 1.1e-101, 90.62% id in 288 aa, and to Pseudomonas fluorescens probable ABC transporter permease protein MtlG SWALL:O30493 (EMBL:AF007800) (276 aa) fasta scores: E(): 3e-70, 65.67% id in 268 aa, and to Pseudomonas aeruginosa probable binding-protein-dependent maltose/mannitol transport protein pa2340 SWALL:Q9I1D8 (EMBL:AE004660) (277 aa) fasta scores: E(): 7.3e-70, 66.41% id in 268 aa | genbank | 52208883 | CAH34822.1 | 288 | 965548 | 966414 | |
| 145598 | hypothetical | BPSL0832 | putative haloacid dehalogenase hydrolase Similar to Ralstonia solanacearum probable transmembrane protein rsc2141 or rs01462 SWALL:Q8XXH3 (EMBL:AL646068) (232 aa) fasta scores: E(): 2.1e-58, 70.25% id in 232 aa, and to Pseudomonas aeruginosa probable hydrolase pa0562 SWALL:Q9I5X4 (EMBL:AE004492) (224 aa) fasta scores: E(): 9.9e-30, 47.08% id in 223 aa, and to Xanthomonas axonopodis hydrolase xac2883 SWALL:AAM37728 (EMBL:AE011930) (225 aa) fasta scores: E(): 2.4e-27, 45.87% id in 218 aa | genbank | 52208884 | CAH34823.1 | 232 | 966411 | 967109 | |
| 145599 | hypothetical | BPSL0833 | putative sugar ABC transporter protein Similar to Salmonella typhimurium maltose/maltodextrin transport ATP-binding protein MalK or stm4230 SWALL:MALK_SALTY (SWALL:P19566) (369 aa) fasta scores: E(): 2.6e-62, 54.14% id in 362 aa, and to Ralstonia solanacearum probable sugar ATP-binding ABC transporter protein rsc2140 or rs01463 SWALL:Q8XXH4 (EMBL:AL646068) (369 aa) fasta scores: E(): 1.1e-101, 83.51% id in 370 aa, and to Vibrio cholerae maltose/maltodextrin ABC transporter, ATP-binding protein vca0946 SWALL:Q9KL04 (EMBL:AE004421) (373 aa) fasta scores: E(): 1.2e-64, 56.35% id in 362 aa downstream repeat region (cccgccgc)3 and (cccgccgg)3 Alternative start site at codon 20 | genbank | 52208885 | CAH34824.1 | 388 | 967116 | 968282 | |
| 145600 | hypothetical | BPSL0834 | putative exported protein Similar to Clostridium perfringens hypothetical protein CPE0251 SWALL:Q8XNT1 (EMBL:AP003186) (440 aa) fasta scores: E(): 5e-55, 37.67% id in 422 aa. C-terminal region is similar to Fusobacterium nucleatum phosphoserine phosphatase FN0091 SWALL:Q8RH24 (EMBL:AE010523) (366 aa) fasta scores: E(): 2.5e-38, 35.69% id in 381 aa downstream repeat region (cccgccgc)3 and (cccgccgg)3 | genbank | 52208886 | CAH34825.1 | 433 | 968501 | 969802 | |
| 145601 | hypothetical | BPSL0835 | LysR family transcriptional regulator Similar to Pseudomonas aeruginosa probable transcriptional regulator pa2316 SWALL:Q9I1F9 (EMBL:AE004657) (297 aa) fasta scores: E(): 1.4e-77, 68.02% id in 294 aa, and to Agrobacterium tumefaciens transcriptional regulator, LysR family atu4271 or agr_l_1183 SWALL:Q8U828 (EMBL:AE009356) (295 aa) fasta scores: E(): 4.5e-54, 50% id in 294 aa, and to Rhizobium loti transcriptional regulator mll2784 SWALL:Q98HN8 (EMBL:AP003000) (307 aa) fasta scores: E(): 4.1e-53, 50.5% id in 295 aa downstream repeat region (gcg)4 | genbank | 52208887 | CAH34826.1 | 294 | 970247 | 971131 | |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145602 | hypothetical | BPSL0836 | family S12 unassigned peptidase Similar to Pseudomonas aeruginosa hypothetical protein pa2315 SWALL:Q9I1G0 (EMBL:AE004657) (391 aa) fasta scores: E(): 6.8e-89, 67.63% id in 380 aa. C-terminal region is similar to Pseudomonas sp triacylglycerol lipase Lip-1 SWALL:Q9KX30 (EMBL:X61673) (333 aa) fasta scores: E(): 3.2e-76, 66.06% id in 333 aa | genbank | 52208888 | CAH34827.1 | 398 | 971269 | 972465 | |
| 145603 | hypothetical | BPSL0837 | putative transporter protein Similar to Erwinia chrysanthemi sugar efflux transporter B SotB SWALL:SOTB_ERWCH (SWALL:Q9S3J9) (395 aa) fasta scores: E(): 5e-23, 29.59% id in 392 aa, and to Pseudomonas aeruginosa probable MFS transporter pa2314 SWALL:Q9I1G1 (EMBL:AE004657) (417 aa) fasta scores: E(): 5.6e-69, 55.52% id in 389 aa downstream repeat region (gtccgtccggc)3 | genbank | 52208889 | CAH34828.1 | 403 | 972462 | 973673 | |
| 145604 | hypothetical | BPSL0838 | putative transcriptional regulator Similar to Bacillus subtilis deoxyribonucleoside regulator DeoR SWALL:DEOR_BACSU (SWALL:P39140) (313 aa) fasta scores: E(): 2.3e-15, 29.74% id in 316 aa, and to Ralstonia solanacearum putative transcriptional regulator rsc2127 or rs01506 SWALL:Q8XXI6 (EMBL:AL646068) (315 aa) fasta scores: E(): 7.7e-100, 84.98% id in 313 aa, and to Yersinia pestis putative transcriptional regulatory protein ypo2324 SWALL:Q8ZE59 (EMBL:AJ414152) (318 aa) fasta scores: E(): 6.9e-63, 54.6% id in 315 aa downstream repeat region (gtccgtccggc)3 | genbank | 52208890 | CAH34829.1 | 315 | 973846 | 974793 | |
| 145605 | dalK | hypothetical | BPSL0839 | putative carbohydrate kinase Similar to Klebsiella pneumoniae D-xylulose-kinase DalK SWALL:O52719 (EMBL:AF045245) (487 aa) fasta scores: E(): 1.5e-108, 60.87% id in 478 aa, and to Ralstonia solanacearum putative D-arabinitol kinase protein rsc2128 or rs01476 SWALL:Q8XXI5 (EMBL:AL646068) (491 aa) fasta scores: E(): 1.7e-154, 82.15% id in 493 aa, and to Escherichia coli xylulose kinase xylB or b3564 SWALL:XYLB_ECOLI (SWALL:P09099) (484 aa) fasta scores: E(): 1.4e-92, 53.68% id in 488 aa | genbank | 52208891 | CAH34830.1 | 493 | 974880 | 976361 |
| 145606 | dalD | hypothetical | BPSL0840 | putative D-arabinitol 4-dehydrogenase Similar to Klebsiella pneumoniae D-arabinitol 4-dehydrogenase DalD SWALL:DALD_KLEPN (SWALL:O52720) (455 aa) fasta scores: E(): 4.8e-98, 55.95% id in 445 aa, and to Ralstonia solanacearum D-arabinitol 4-dehydrogenase rsc2129 or rs01475 SWALL:DALD_RALSO (SWALL:P58708) (465 aa) fasta scores: E(): 2.5e-147, 78.66% id in 464 aa, and to Yersinia pestis D-arabinitol 4-dehydrogenase ypo2325 or y2008 SWALL:DALD_YERPE (SWALL:P58709) (463 aa) fasta scores: E(): 2.2e-102, 56.58% id in 463 aa. Possible alternative translational start site after codon 17 | genbank | 52208892 | CAH34831.1 | 480 | 976472 | 977914 |
| 145607 | hypothetical | BPSL0841 | putative LysR family transcriptional regulator Similar to Bacillus subtilis transcriptional regulatory protein GltC SWALL:GLTC_BACSU (SWALL:P20668) (300 aa) fasta scores: E(): 3.6e-16, 28.32% id in 286 aa, and to Streptomyces coelicolor putative LysR-family transcriptional regulator sco0925 or scm10.13 SWALL:Q9RCY5 (EMBL:AL133469) (294 aa) fasta scores: E(): 4.1e-18, 33.33% id in 300 aa | genbank | 52208893 | CAH34832.1 | 304 | 978086 | 979000 | |
| 145608 | hypothetical | BPSL0842 | putative benzoylformate decarboxylase Similar to Pseudomonas putida benzoylformate decarboxylase MdlC SWALL:MDLC_PSEPU (SWALL:P20906) (528 aa) fasta scores: E(): 8.1e-74, 43.91% id in 526 aa, and to Pseudomonas aeruginosa benzoylformate decarboxylase pa4901 SWALL:Q9HUR2 (EMBL:AE004903) (528 aa) fasta scores: E(): 5.9e-77, 45.92% id in 527 aa | genbank | 52208894 | CAH34833.1 | 539 | 979101 | 980720 | |
| 145609 | hypothetical | BPSL0843 | aldehyde dehydrogenase family protein Similar to previously sequenced Burkholderia sp. RP007 dehydrogenase PhnF SWALL:Q9ZHH7 (EMBL:AF061751) (483 aa) fasta scores: E(): 1.1e-103, 61.41% id in 482 aa. Similar to Rhizobium loti dehydrogenase mll7197 SWALL:Q986V2 (EMBL:AP003011) (481 aa) fasta scores: E(): 1.7e-114, 66.73% id in 481 aa, and to Ralstonia solanacearum probable vanillin dehydrogenase oxidoreductase protein Vdh or rsp0226 or rs05197 SWALL:Q8XT89 (EMBL:AL646077) (484 aa) fasta scores: E(): 2.7e-111, 65.63% id in 483 aa Alternative start site at codon 11 | genbank | 52208895 | CAH34834.1 | 483 | 980842 | 982293 | |
| 145610 | hypothetical | BPSL0844 | putative ketopantoate reductase Similar to Escherichia coli 2-dehydropantoate 2-reductase PanE or ApbA or b0425 SWALL:PANE_ECOLI (SWALL:P77728) (303 aa) fasta scores: E(): 2.8e-07, 27.77% id in 306 aa, and to Salmonella typhimurium putative ketopantoate reductase stm2573 SWALL:Q8ZN23 (EMBL:AE008817) (305 aa) fasta scores: E(): 1.1e-30, 38.33% id in 313 aa, and to Salmonella typhi putative oxidoreductase sty2819 SWALL:Q8Z4L0 (EMBL:AL627275) (305 aa) fasta scores: E(): 1.8e-30, 39.17% id in 314 aa | genbank | 52208896 | CAH34835.1 | 310 | 982322 | 983254 | |
| 145611 | hypothetical | BPSL0844a | hypothetical protein Doubtful CDS. No significant database matches | genbank | 52208897 | CAH34836.1 | 77 | 983744 | 983977 | |
| 145612 | hypothetical | BPSL0845 | putative transporter protein Similar to Pseudomonas putida 4-hydroxybenzoate transporter PcaK SWALL:PCAK_PSEPU (SWALL:Q51955) (448 aa) fasta scores: E(): 6.3e-43, 36.14% id in 451 aa, and to Ralstonia solanacearum putative 4-hydroxybenzoate transporter transmembrane protein rsc1093 or rs04094 SWALL:Q8Y0F1 (EMBL:AL646062) (454 aa) fasta scores: E(): 6.2e-47, 36.02% id in 458 aa, and to Pseudomonas aeruginosa probable MFS transporter pa2472 SWALL:Q9I110 (EMBL:AE004675) (448 aa) fasta scores: E(): 1.7e-45, 37.13% id in 439 aa | genbank | 52208898 | CAH34837.1 | 464 | 983974 | 985368 | |
| 145613 | hypothetical | BPSL0846 | putative tryptophan 2,3-dioxygenase Similar to Ralstonia solanacearum putative oxygenase oxidoreductase protein rsc0758 or rs05095 SWALL:Q8Y1D2 (EMBL:AL646060) (294 aa) fasta scores: E(): 1.2e-83, 71.13% id in 291 aa. Weakly similar to the N-terminal region of Homo sapiens tryptophan 2,3-dioxygenase TDO2 or TDO SWALL:T23O_HUMAN (SWALL:P48775) (406 aa) fasta scores: E(): 0.011, 28.15% id in 373 aa | genbank | 52208899 | CAH34838.1 | 306 | 985394 | 986314 | |
| 145614 | hypothetical | BPSL0847 | conserved hypothetical protein Similar to Pseudomonas aeruginosa hypothetical protein pa2080 SWALL:Q9I235 (EMBL:AE004635) (416 aa) fasta scores: E(): 3.6e-112, 66.58% id in 416 aa, and to Ralstonia solanacearum probable hydrolase protein rsc0759 or rs05094 SWALL:Q8Y1D1 (EMBL:AL646060) (417 aa) fasta scores: E(): 1.3e-111, 67.95% id in 415 aa, and to Rattus norvegicus Kynureninase KynU SWALL:KYNU_RAT (SWALL:P70712) (464 aa) fasta scores: E(): 1.7e-13, 27.98% id in 436 aa, and to Streptomyces clavuligerus isopenicillin N epimerase CefD SWALL:CEFD_STRCL (SWALL:P18549) (397 aa) fasta scores: E(): 2.3e-07, 24.37% id in 402 aa | genbank | 52208900 | CAH34839.1 | 416 | 986413 | 987663 | |
| 145615 | hypothetical | BPSL0848 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc0760 or rs05093 SWALL:Q8Y1D0 (EMBL:AL646060) (209 aa) fasta scores: E(): 5.8e-59, 74.87% id in 207 aa, and to Pseudomonas aeruginosa hypothetical protein pa2081 SWALL:Q9I234 (EMBL:AE004635) (213 aa) fasta scores: E(): 5.4e-52, 67.15% id in 207 aa, and to Synechocystis sp. hypothetical protein slr2121 SWALL:P73988 (EMBL:D90911) (215 aa) fasta scores: E(): 4.9e-14, 29.32% id in 208 aa | genbank | 52208901 | CAH34840.1 | 213 | 987705 | 988346 | |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145616 | hypothetical | BPSL0849 | AsnC family transcriptional regulator Similar to Rhizobium meliloti leucine-responsive regulatory protein Lrp or r01568 or smc01223 SWALL:LRP_RHIME (SWALL:P56901) (156 aa) fasta scores: E(): 5.9e-19, 41.78% id in 146 aa, and to Ralstonia solanacearum probable transcription regulator protein rsc0761 or rs05092 SWALL:Q8Y1C9 (EMBL:AL646060) (176 aa) fasta scores: E(): 4.1e-37, 65.1% id in 149 aa, and to Pseudomonas aeruginosa probable transcriptional regulator pa2082 SWALL:Q9I233 (EMBL:AE004636) (158 aa) fasta scores: E(): 1.7e-32, 62.06% id in 145 aa | genbank | 52208902 | CAH34841.1 | 167 | 988476 | 988979 | |
| 145617 | hypothetical | BPSL0850 | conserved hypothetical protein Similar to Ralstonia solanacearum putative monooxygenase oxidoreductase protein rsc0763 or rs05090 SWALL:Q8Y1C7 (EMBL:AL646060) (191 aa) fasta scores: E(): 2.6e-42, 66.47% id in 170 aa, and to Agrobacterium tumefaciens nitrilotriacetate monooxygenase atu3277 or agr_l_3083 SWALL:Q8UAU0 (EMBL:AE009257) (175 aa) fasta scores: E(): 1.9e-23, 47.23% id in 163 aa. Similar to the N-terminal region of Chelatobacter heintzii nitrilotriacetate monooxygenase component B NtaB or NmoB SWALL:NTAB_CHEHE (SWALL:P54990) (322 aa) fasta scores: E(): 9.3e-20, 41.21% id in 165 aa. | genbank | 52208903 | CAH34842.1 | 171 | 988966 | 989481 | |
| 145618 | hypothetical | BPSL0851 | putative peptide methionine sulfoxide reductase Similar to Erwinia chrysanthemi peptide methionine sulfoxide reductase MsrA SWALL:MSRA_ERWCH (SWALL:Q9ZEQ8) (213 aa) fasta scores: E(): 1.7e-25, 46.87% id in 160 aa, and to Ralstonia solanacearum peptide methionine sulfoxide reductase rsc0764 or rs05089 SWALL:MSRA_RALSO (SWALL:Q8Y1C6) (191 aa) fasta scores: E(): 2.9e-43, 60.21% id in 186 aa, and to Deinococcus radiodurans peptide methionine sulfoxide reductase dr1849 SWALL:MSRA_DEIRA (SWALL:Q9RTB6) (206 aa) fasta scores: E(): 8.3e-40, 56.18% id in 178 aa | genbank | 52208904 | CAH34843.1 | 185 | 989874 | 990431 | |
| 145619 | hypothetical | BPSL0852 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc0765 or rs05088 SWALL:Q8Y1C5 (EMBL:AL646060) (355 aa) fasta scores: E(): 3.2e-54, 53.46% id in 346 aa. Alternative start at codon 80 | genbank | 52208905 | CAH34844.1 | 387 | 990788 | 991951 | |
| 145620 | hypothetical | BPSL0853 | putative cyclopropane-fatty-acyl-phospholipid synthase Similar to Ralstonia solanacearum putative cyclopropane-fatty-acyl-phospholipid synthase protein Cfa2 or rsc0766 or rs05087 SWALL:Q8Y1C4 (EMBL:AL646060) (406 aa) fasta scores: E(): 1.5e-111, 68.84% id in 398 aa, and to Pseudomonas aeruginosa hypothetical protein pa5546 SWALL:Q9HT28 (EMBL:AE004967) (394 aa) fasta scores: E(): 1.6e-73, 49.11% id in 397 aa, and to Pseudomonas putida hypothetical protein SWALL:YLP3_PSEPU (SWALL:P31049) (394 aa) fasta scores: E(): 7.8e-67, 45.83% id in 384 aa Upstream repeat (ccgc)3 and downstream repeat (gcg)4 | genbank | 52208906 | CAH34845.1 | 406 | 992374 | 993594 | |
| 145621 | pdxH | hypothetical | BPSL0854 | putative pyridoxamine 5'-phosphate oxidase Similar to Synechocystis sp. pyridoxamine 5'-phosphate oxidase PdxH or sll1440 SWALL:PDXH_SYNY3 (SWALL:P74211) (230 aa) fasta scores: E(): 6.9e-45, 53.05% id in 213 aa, and to Ralstonia solanacearum probable pyridoxamine 5'-phosphate oxidase rsc0767 or rs05086 SWALL:Q8Y1C3 (EMBL:AL646060) (212 aa) fasta scores: E(): 5.2e-59, 68.69% id in 214 aa, and to Anabaena sp. pyridoxamine 5-phosphate oxidase all1248 SWALL:Q8YXG5 (EMBL:AP003585) (214 aa) fasta scores: E(): 1.2e-51, 60.56% id in 213 aa downstream repeat region (ccgc)3 | genbank | 52208907 | CAH34846.1 | 220 | 993726 | 994388 |
| 145622 | hypothetical | BPSL0855 | ThiF family protein Similar to Ralstonia solanacearum probable transmembrane protein rsc0774 or rs05080 SWALL:Q8Y1B6 (EMBL:AL646061) (300 aa) fasta scores: E(): 4.9e-51, 60.48% id in 291 aa, and to Salmonella typhimurium paral putative enzyme stm2987 SWALL:Q8ZMC1 (EMBL:AE008837) (268 aa) fasta scores: E(): 7.7e-50, 53.33% id in 270 aa | genbank | 52208908 | CAH34847.1 | 288 | 994504 | 995370 | |
| 145623 | hypothetical | BPSL0856 | putative thioredoxin protein Similar to Ralstonia solanacearum putative thioredoxin protein rsc0779 or rs05075 SWALL:Q8Y1B1 (EMBL:AL646061) (280 aa) fasta scores: E(): 2.9e-54, 55.51% id in 281 aa, and to Pseudomonas aeruginosa probable thioredoxin pa4061 SWALL:Q9HWW7 (EMBL:AE004822) (289 aa) fasta scores: E(): 1e-32, 42.1% id in 285 aa, and to Xanthomonas axonopodis thioredoxin xac2783 SWALL:AAM37628 (EMBL:AE011919) (286 aa) fasta scores: E(): 9.5e-32, 41.07% id in 280 aa | genbank | 52208909 | CAH34848.1 | 301 | 995643 | 996548 | |
| 145624 | hypothetical | BPSL0857 | conserved hypothetical protein Similar to Streptomyces coelicolor hypothetical protein sco0881 or scm1.14C SWALL:Q9RD29 (EMBL:AL133422) (321 aa) fasta scores: E(): 3.4e-32, 38.98% id in 295 aa, and to Pseudomonas aeruginosa hypothetical protein pa1205 SWALL:YC05_PSEAE (SWALL:Q9I4D3) (315 aa) fasta scores: E(): 8e-32, 40.07% id in 257 aa, and to Streptomyces coelicolor hypothetical protein sco7729 or sc8d11.20 SWALL:Q9AJZ9 (EMBL:AL512944) (332 aa) fasta scores: E(): 1.7e-28, 37.36% id in 281 aa, and to Mus musculus pirin PIR SWALL:PIR_MOUSE (SWALL:Q9D711) (290 aa) fasta scores: E(): 8e-18, 31.14% id in 289 aa | genbank | 52208910 | CAH34849.1 | 293 | 996545 | 997426 | |
| 145625 | hypothetical | BPSL0858 | putative permease protein Similar to Salmonella typhimurium probable amino acid metabolite efflux pump EamA or stm1517 SWALL:EAMA_SALTY (SWALL:Q56072) (299 aa) fasta scores: E(): 1.4e-53, 53.92% id in 293 aa, and to Ralstonia solanacearum hypothetical transmembrane protein rsc3261 or rs02490 SWALL:Q8XUD0 (EMBL:AL646074) (308 aa) fasta scores: E(): 5.3e-65, 63.54% id in 299 aa, and to Salmonella typhi putative membrane protein sty1543 SWALL:Q8Z701 (EMBL:AL627270) (300 aa) fasta scores: E(): 1.2e-53, 53.92% id in 293 aa | genbank | 52208911 | CAH34850.1 | 294 | 997611 | 998495 | |
| 145626 | hypothetical | BPSL0859 | putative N-acetylmuramoyl-L-alanine amidase Similar to Escherichia coli N-acetylmuramoyl-L-alanine amidase AmiC or b2817 SWALL:AMIC_ECOLI (SWALL:Q46929) (417 aa) fasta scores: E(): 1.3e-34, 42.85% id in 490 aa, and to Ralstonia solanacearum probable N-acetylmuramoyl-L-alanine amidase rsc2539 or rs00715 SWALL:Q8XWD5 (EMBL:AL646070) (507 aa) fasta scores: E(): 2.1e-52, 57.39% id in 521 aa, and to Yersinia pestis N-acetylmuramoyl-L-alanine amidase ypo1023 SWALL:Q8ZH85 (EMBL:AJ414146) (416 aa) fasta scores: E(): 4.9e-36, 41.36% id in 498 aa | genbank | 52208912 | CAH34851.1 | 514 | 999015 | 1000559 | |
| 145627 | hypothetical | BPSL0860 | putative hydrolase Similar to Ralstonia solanacearum hypothetical protein rsc2540 or rs00716 SWALL:Q8XWD4 (EMBL:AL646070) (198 aa) fasta scores: E(): 8.5e-29, 58.28% id in 163 aa, and to Salmonella typhi hypothetical protein sty4714 SWALL:Q8Z189 (EMBL:AL627283) (153 aa) fasta scores: E(): 5.3e-20, 48.79% id in 166 aa, and to Salmonella typhimurium putative nucleotide-binding protein stm4357 SWALL:Q8ZKA6 (EMBL:AE008904) (153 aa) fasta scores: E(): 8.1e-20, 48.19% id in 166 aa, and to Escherichia coli, and Escherichia coli O157:H7 hypothetical protein b4168 or z5775 or ecs5144 SWALL:YJEE_ECOLI (SWALL:P31805) (153 aa) fasta scores: E(): 2.2e-19, 48.79% id in 166 aa | genbank | 52208913 | CAH34852.1 | 184 | 1000553 | 1001107 | |
| 145628 | hypothetical | BPSL0861 | putative 4Fe-4S cluster-binding ferredoxin protein Similar to Pseudomonas aeruginosa hypothetical protein pa4950 SWALL:Q9HUL4 (EMBL:AE004908) (361 aa) fasta scores: E(): 7.6e-57, 59.15% id in 377 aa, and to Yersinia pestis putative iron-sulfur cluster-binding protein ypo0367 SWALL:Q8ZIW8 (EMBL:AJ414142) (411 aa) fasta scores: E(): 1e-42, 47.18% id in 409 aa, and to Ralstonia solanacearum putative iron-sulfur 4Fe-4S ferredoxin protein rsc2541 or rs00718 SWALL:Q8XWD3 (EMBL:AL646070) (360 aa) fasta scores: E(): 8.8e-39, 64.45% id in 377 aa. Possible alternative translational start site | genbank | 52208914 | CAH34853.1 | 409 | 1001125 | 1002354 | |
| 145629 | hypothetical | BPSL0862 | putative methylated-DNA--protein-cysteine methyltransferase Similar to Salmonella typhimurium, and Salmonella typhi methylated-DNA--protein-cysteine methyltransferase Ogt or stm1659 or sty1405 SWALL:OGT_SALTY (SWALL:P37429) (171 aa) fasta scores: E(): 2.7e-12, 43.18% id in 132 aa, and to Ralstonia solanacearum probable methylated-DNA--protein-cysteine methyltransferase rsc2543 or rs00722 SWALL:Q8XWD1 (EMBL:AL646070) (173 aa) fasta scores: E(): 2.6e-38, 57.31% id in 164 aa, and to Chlorobium tepidum methylated-DNA-protein-cysteine methyltransferase ct1289 SWALL:AAM72519 (EMBL:AE012888) (165 aa) fasta scores: E(): 1.2e-15, 39.86% id in 148 aa | genbank | 52208915 | CAH34854.1 | 174 | 1002367 | 1002891 | |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145630 | xerD | hypothetical | BPSL0863 | putative integrase/recombinase Similar to Salmonella typhimurium, and Salmonella typhi integrase/recombinase XerD or stm3044 or sty3200 SWALL:XERD_SALTY (SWALL:P55889) (298 aa) fasta scores: E(): 1.1e-55, 56.31% id in 293 aa, and to Ralstonia solanacearum probable integrase/recombinase protein rsc2544 or rs00723 SWALL:Q8XWD0 (EMBL:AL646070) (308 aa) fasta scores: E(): 3.9e-80, 71.86% id in 295 aa, and to Pseudomonas aeruginosa integrase/recombinase XerD or pa3738 SWALL:Q9HXQ6 (EMBL:AE004793) (298 aa) fasta scores: E(): 3.6e-61, 59.79% id in 291 aa | genbank | 52208916 | CAH34855.1 | 333 | 1002891 | 1003892 |
| 145631 | hypothetical | BPSL0864 | putative AMP-binding enzyme Similar to Streptomyces coelicolor probable long-chain-fatty-acid-CoA ligase sco6968 or sc6f7.21 SWALL:Q9KZC1 (EMBL:AL353870) (511 aa) fasta scores: E(): 2.7e-47, 37.37% id in 511 aa, and to Thermoanaerobacter tengcongensis acyl-CoA synthetases tte1960 SWALL:Q8R8N5 (EMBL:AE013147) (495 aa) fasta scores: E(): 2.8e-44, 33.53% id in 489 aa | genbank | 52208917 | CAH34856.1 | 521 | 1004177 | 1005742 | |
| 145632 | hypothetical | BPSL0865 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc2545 or rs00724 SWALL:Q8XWC9 (EMBL:AL646070) (163 aa) fasta scores: E(): 7.9e-50, 76.39% id in 161 aa, and to Neisseria meningitidis hypothetical protei nma1462 SWALL:Q9JU74 (EMBL:AL162756) (159 aa) fasta scores: E(): 3.5e-30, 49.36% id in 158 aa, and to Neisseria meningitidis hypothetical protein nmb1026 SWALL:Q9JZJ3 (EMBL:AE002453) (159 aa) fasta scores: E(): 4.8e-30, 49.36% id in 158 aa | genbank | 52208918 | CAH34857.1 | 163 | 1005872 | 1006363 | |
| 145633 | hypothetical | BPSL0866 | putative membrane protein Similar to Ralstonia solanacearum probable transmembrane protein rsc2546 or rs00725 SWALL:Q8XWC8 (EMBL:AL646070) (207 aa) fasta scores: E(): 7.7e-49, 74.11% id in 197 aa, and to Neisseria meningitidis hypothetical protein nmb1062 SWALL:Q9JZG9 (EMBL:AE002456) (200 aa) fasta scores: E(): 3.3e-33, 54.31% id in 197 aa, and to Neisseria meningitidis putative integral membrane protein nma1261 SWALL:Q9JUL4 (EMBL:AL162755) (200 aa) fasta scores: E(): 7.9e-33, 52.76% id in 199 aa | genbank | 52208919 | CAH34858.1 | 203 | 1006472 | 1007083 | |
| 145634 | hypothetical | BPSL0867 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc2549 or rs00728 SWALL:Q8XWC5 (EMBL:AL646070) (161 aa) fasta scores: E(): 7.4e-43, 81.36% id in 161 aa, and to Vibrio cholerae hypothetical protein vc1508 SWALL:Q9KRX5 (EMBL:AE004229) (160 aa) fasta scores: E(): 1e-24, 51.55% id in 161 aa, and to Xanthomonas axonopodis hypothetical protein Xac3671 xac3671 SWALL:AAM38514 (EMBL:AE012017) (161 aa) fasta scores: E(): 2.1e-21, 46.62% id in 163 aa | genbank | 52208920 | CAH34859.1 | 161 | 1007313 | 1007798 | |
| 145635 | murB | hypothetical | BPSL0868 | putative UDP-N-acetylenolpyruvoylglucosamine reductase Similar to Bordetella pertussis UDP-N-acetylenolpyruvoylglucosamine reductase MurB SWALL:MURB_BORPE (SWALL:Q9X6Y8) (351 aa) fasta scores: E(): 1.9e-65, 54.91% id in 346 aa, and to Ralstonia solanacearum probable UDP-N-acetylenolpyruvoylglucosamine reductase oxidoreductase protein rsc2550 or rs00729 SWALL:Q8XWC4 (EMBL:AL646070) (342 aa) fasta scores: E(): 7.2e-72, 59.23% id in 341 aa downstream repeat region (ggcgag)3 | genbank | 52208921 | CAH34860.1 | 349 | 1007935 | 1008984 |
| 145636 | argF | hypothetical | BPSL0869 | putative ornithine carbamoyltransferase Similar to Pseudomonas aeruginosa ornithine carbamoyltransferase, anabolic ArgF or pa3537 SWALL:OTCA_PSEAE (SWALL:P11724) (304 aa) fasta scores: E(): 1.6e-63, 53.51% id in 299 aa, and to Ralstonia solanacearum probable ornithine carbamoyltransferase protein rsc2554 or rs00733 SWALL:Q8XWC0 (EMBL:AL646070) (308 aa) fasta scores: E(): 4.2e-100, 79.06% id in 301 aa downstream repeat region (ggcgag)3 | genbank | 52208922 | CAH34861.1 | 309 | 1009176 | 1010105 |
| 145637 | hypothetical | BPSL0870 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc2555 or rs00734 SWALL:Q8XWB9 (EMBL:AL646070) (117 aa) fasta scores: E(): 4.7e-20, 56.25% id in 96 aa, and to Neisseria meningitidis hypothetical protein nma0169 SWALL:Q9JWY5 (EMBL:AL162752) (280 aa) fasta scores: E(): 1e-11, 45.16% id in 93 aa, and to Neisseria meningitidis phno-related protein nmb0105 SWALL:Q9K1L0 (EMBL:AE002369) (280 aa) fasta scores: E(): 1.2e-11, 45.16% id in 93 aa | genbank | 52208923 | CAH34862.1 | 111 | 1010519 | 1010854 | |
| 145638 | rpsT | hypothetical | BPSL0871 | putative 30S ribosomal protein S20 Similar to Escherichia coli, and Escherichia coli O157:H7 30S ribosomal protein S20 RpsT or b0023 or z0027 or ecs0026 SWALL:RS20_ECOLI (SWALL:P02378) (86 aa) fasta scores: E(): 6.5e-09, 48.23% id in 85 aa, and to Ralstonia solanacearum 30S ribosomal protein S20 rsc2556 or rs00735 SWALL:RS20_RALSO (SWALL:Q8XWB8) (88 aa) fasta scores: E(): 5.7e-19, 73.86% id in 88 aa, and to Neisseria meningitidis 30S ribosomal protein S20 nma2022 or nmb0463 SWALL:RS20_NEIMA (SWALL:Q9JQM6) (87 aa) fasta scores: E(): 4e-16, 63.95% id in 86 aa | genbank | 52208924 | CAH34863.1 | 92 | 1011098 | 1011376 |
| 145639 | hypothetical | BPSL0872 | MviN-like protein Similar to Ralstonia solanacearum probable transmembrane protein rsc2557 or rs00736 SWALL:Q8XWB7 (EMBL:AL646070) (517 aa) fasta scores: E(): 2.3e-128, 65.69% id in 516 aa, and to Yersinia pestis putative membrane protein ypo2043 SWALL:Q8ZEW0 (EMBL:AJ414151) (511 aa) fasta scores: E(): 9.6e-97, 52.7% id in 518 aa, and to Escherichia coli, and Escherichia coli O157:H7 virulence factor MviN homolog b1069 or z1707 or ecs1447 SWALL:MVIN_ECOLI (SWALL:P75932) (511 aa) fasta scores: E(): 2.6e-96, 52.23% id in 515 aa | genbank | 52208925 | CAH34864.1 | 516 | 1011781 | 1013331 | |
| 145640 | hypothetical | BPSL0873 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc2558 or rs00740 SWALL:Q8XWB6 (EMBL:AL646070) (281 aa) fasta scores: E(): 4.2e-61, 58.27% id in 278 aa, and to Xylella fastidiosa hypothetical protein xf1494 SWALL:YE94_XYLFA (SWALL:Q9PD85) (281 aa) fasta scores: E(): 4.3e-33, 38.84% id in 278 aa, and to Xanthomonas campestris hypothetical protein xcc3267 SWALL:AAM42537 (EMBL:AE012443) (293 aa) fasta scores: E(): 8.7e-32, 39.06% id in 279 aa | genbank | 52208926 | CAH34865.1 | 280 | 1013341 | 1014183 | |
| 145641 | hypothetical | BPSL0874 | putative short-chain dehydrogenase family protein Similar to Ralstonia solanacearum probable 3-hydroxyacyl-CoA dehydrogenase type II oxidoreductase protein rsc2534 or rs05766 SWALL:Q8XWE0 (EMBL:AL646070) (252 aa) fasta scores: E(): 2.2e-67, 77.77% id in 252 aa, and to Pseudomonas aeruginosa probable short-chain dehydrogenase pa2554 SWALL:Q9I0T0 (EMBL:AE004683) (255 aa) fasta scores: E(): 1.4e-56, 66.66% id in 255 aa, and to Brucella melitensis 3-oxoacyl-(acyl-carrier protein) reductase bmeii0816 SWALL:Q8YBS0 (EMBL:AE009715) (255 aa) fasta scores: E(): 7e-56, 65.88% id in 255 aa | genbank | 52208927 | CAH34866.1 | 252 | 1014452 | 1015210 | |
| 145642 | adk | hypothetical | BPSL0875 | putative adenylate kinase Similar to Bordetella pertussis adenylate kinase Adk SWALL:KAD_BORPE (SWALL:P39068) (218 aa) fasta scores: E(): 6.2e-59, 71.36% id in 220 aa, and to Ralstonia solanacearum adenylate kinase rsc2533 or rs05765 SWALL:KAD_RALSO (SWALL:Q8XWE1) (222 aa) fasta scores: E(): 2.5e-61, 74.88% id in 223 aa | genbank | 52208928 | CAH34867.1 | 220 | 1015408 | 1016070 |
| 145643 | kdsB | hypothetical | BPSL0876 | putative 3-deoxy-manno-octulosonate cytidylyltransferase Similar to Escherichia coli 3-deoxy-manno-octulosonate cytidylyltransferase KdsB or b0918 SWALL:KDSB_ECOLI (SWALL:P04951) (247 aa) fasta scores: E(): 5.3e-45, 53.75% id in 253 aa, and to Ralstonia solanacearum probable 3-deoxy-manno-octulosonate KdsB or rsc2532 or rs05764 SWALL:Q8XWE2 (EMBL:AL646070) (268 aa) fasta scores: E(): 2e-58, 66.92% id in 257 aa, and to Escherichia coli O157:H7 3-deoxy-manno-octulosonate cytidylyltransferase KdsB or z1264 or ecs1001 SWALL:Q8XDG6 (EMBL:AE005281) (248 aa) fasta scores: E(): 2.7e-45, 53.72% id in 255 aa | genbank | 52208929 | CAH34868.1 | 278 | 1016279 | 1017115 |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145644 | hypothetical | BPSL0877 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc2531 or rs05763 SWALL:Q8XWE3 (EMBL:AL646070) (62 aa) fasta scores: E(): 1.9e-19, 82.25% id in 62 aa, and to Caulobacter crescentus hypothetical protein cc0108 SWALL:Q9ABW2 (EMBL:AE005685) (65 aa) fasta scores: E(): 3.4e-11, 62.5% id in 56 aa, and to Vibrio cholerae hypothetical protein vc1876 SWALL:Q9KQX1 (EMBL:AE004263) (59 aa) fasta scores: E(): 4.4e-11, 64.7% id in 51 aa | genbank | 52208930 | CAH34869.1 | 68 | 1017244 | 1017450 | |
| 145645 | hypothetical | BPSL0878 | putative tetraacyldisaccharide 4'-kinase Similar to Escherichia coli tetraacyldisaccharide 4'-kinase LpxK or b0915 SWALL:LPXK_ECOLI (SWALL:P27300) (328 aa) fasta scores: E(): 1.8e-35, 44.82% id in 319 aa, and to Ralstonia solanacearum tetraacyldisaccharide 4'-kinase rsc2530 or rs01051 SWALL:LPXK_RALSO (SWALL:Q8XWE4) (349 aa) fasta scores: E(): 4.4e-66, 58.3% id in 331 aa, and to Xanthomonas axonopodis tetraacyldisaccharide 4'-kinase xac2088 SWALL:LPXK_XANAC (SWALL:Q8PKS4) (345 aa) fasta scores: E(): 9.1e-39, 47.67% id in 323 aa | genbank | 52208931 | CAH34870.1 | 342 | 1017431 | 1018459 | |
| 145646 | hypothetical | BPSL0879 | putative exodeoxyribonuclease VII large subunit Similar to Escherichia coli exodeoxyribonuclease VII large subunit XseA or b2509 SWALL:EX7L_ECOLI (SWALL:P04994) (456 aa) fasta scores: E(): 8.3e-57, 41.13% id in 440 aa, and to Ralstonia solanacearum probable exodeoxyribonuclease VII large subunit rsc2527 or rs01054 SWALL:Q8XWE7 (EMBL:AL646070) (440 aa) fasta scores: E(): 3.3e-93, 60.9% id in 440 aa, and to Neisseria meningitidis probable exodeoxyribonuclease VII large subunit nma1575 SWALL:EX7L_NEIMA (SWALL:Q9JTY8) (451 aa) fasta scores: E(): 7.7e-73, 50.79% id in 443 aa. Possible alternative translational start site Upstream repeat region (cgcgcgg)3 | genbank | 52208932 | CAH34871.1 | 460 | 1018910 | 1020292 | |
| 145647 | sodB | hypothetical | BPSL0880 | putative superoxide dismutase Similar to Bordetella pertussis superoxide dismutase [Fe] SodB SWALL:SODF_BORPE (SWALL:P37369) (192 aa) fasta scores: E(): 6.4e-69, 83.33% id in 192 aa, and to Ralstonia solanacearum probable superoxide dismutase rsc2526 or rs01055 SWALL:Q8XWE8 (EMBL:AL646070) (192 aa) fasta scores: E(): 1.2e-70, 85.41% id in 192 aa | genbank | 52208933 | CAH34872.1 | 192 | 1020489 | 1021067 |
| 145648 | hypothetical | BPSL0881 | hypothetical protein No significant database matches | genbank | 52208934 | CAH34873.1 | 422 | 1021502 | 1022770 | |
| 145649 | hypothetical | BPSL0882 | putative chromate transporter protein Similar to Pseudomonas aeruginosa chromate transport protein ChrA SWALL:CHRA_PSEAE (SWALL:P14285) (416 aa) fasta scores: E(): 1.4e-19, 29% id in 400 aa, and to Pseudomonas aeruginosa probable transporter pa4289 SWALL:Q9HWB1 (EMBL:AE004845) (401 aa) fasta scores: E(): 2.8e-88, 65.23% id in 397 aa, and to Agrobacterium tumefaciens chromate transport protein atu3079 or agr_l_3461 SWALL:Q8UBD7 (EMBL:AE009239) (409 aa) fasta scores: E(): 6.2e-75, 55.61% id in 392 aa downstream repeat region | genbank | 52208935 | CAH34874.1 | 401 | 1023539 | 1024744 | |
| 145650 | hypothetical | BPSL0883 | putative regulatory protein Similar to Pseudomonas aeruginosa probable transcriptional regulator pa0275 SWALL:Q9I6L5 (EMBL:AE004465) (228 aa) fasta scores: E(): 1.1e-40, 56.3% id in 222 aa, and to Ralstonia solanacearum putative transcription regulator protein rsp0805 or rs01902 SWALL:Q8XRM6 (EMBL:AL646081) (239 aa) fasta scores: E(): 3.7e-38, 52.21% id in 226 aa | genbank | 52208936 | CAH34875.1 | 251 | 1024978 | 1025733 | |
| 145651 | hypothetical | BPSL0884 | putative membrane protein Similar to Pseudomonas aeruginosa hypothetical protein pa0276 SWALL:Q9I6L4 (EMBL:AE004465) (171 aa) fasta scores: E(): 7e-44, 69.71% id in 175 aa, and to Pseudomonas putida Prs2-like protein SWALL:Q9WWZ6 (EMBL:AF031417) (174 aa) fasta scores: E(): 3.2e-40, 62.85% id in 175 aa | genbank | 52208937 | CAH34876.1 | 175 | 1025818 | 1026345 | |
| 145652 | hypothetical | BPSL0885 | putative ketopantoate reductase Similar to Ralstonia solanacearum probable lipoprotein oxidoreductase rsp1244 or rs03188 SWALL:Q8XQI1 (EMBL:AL646083) (338 aa) fasta scores: E(): 6.8e-85, 69.61% id in 339 aa, and to Rhodococcus erythropolis hypothetical protein Orf12 SWALL:P72266 (EMBL:Z82004) (367 aa) fasta scores: E(): 2.5e-70, 62.04% id in 332 aa | genbank | 52208938 | CAH34877.1 | 341 | 1026361 | 1027386 | |
| 145653 | hypothetical | BPSL0886 | conserved hypothetical protein Similar to Ralstonia solanacearum hypothetical protein rsc3026 or rs04731 SWALL:Q8XV06 (EMBL:AL646073) (196 aa) fasta scores: E(): 1e-40, 58.67% id in 196 aa upstream repeat region (tgccgagt)3 | genbank | 52208939 | CAH34878.1 | 201 | 1027910 | 1028515 | |
| 145654 | hypothetical | BPSL0887 | hypothetical protein Weakly similar to Clostridium acetobutylicum sensory protein, containing EAL-domain cac0322 SWALL:Q97M76 (EMBL:AE007546) (412 aa) fasta scores: E(): 4.5e-19, 25.76% id in 392 aa, and to Rhizobium loti hypothetical protein mll2537 SWALL:Q98I70 (EMBL:AP002999) (282 aa) fasta scores: E(): 2.8e-14, 31.22% id in 237 aa upstream repeat region (cccgaacgcccgaacgcccgaacg)3 and (cccgaaca)3 | genbank | 52208940 | CAH34879.1 | 424 | 1028626 | 1029900 | |
| 145655 | hypothetical | BPSL0888 | putative transporter protein Similar to Ralstonia solanacearum probable transporter transmembrane protein rsp1278 or rs05323 SWALL:Q8XQE9 (EMBL:AL646083) (476 aa) fasta scores: E(): 1.2e-105, 61.7% id in 470 aa, and to Xanthomonas campestris MFS transporter EmrA or xcc2845 SWALL:AAM42117 (EMBL:AE012397) (473 aa) fasta scores: E(): 9.4e-98, 58.35% id in 461 aa downstream repeat region (cccgaacgcccgaacgcccgaacg)3 and (cccgaaca)3 | genbank | 52208941 | CAH34880.1 | 479 | 1030572 | 1032011 | |
| 145656 | hypothetical | BPSL0889 | hypothetical protein Doubtful CDS. No significant hits in the databases | genbank | 52208942 | CAH34881.1 | 111 | 1032308 | 1032643 | |
| 145657 | hypothetical | BPSL0890 | putative citrate synthase C-terminal region is similar to Agrobacterium tumefaciens citrate synthase CisZ or atu4851 or agr_l_71 SWALL:Q8U6F6 (EMBL:AE009414) (335 aa) fasta scores: E(): 6.7e-14, 42.68% id in 335 aa, and to Staphylococcus aureus citrate synthase II CitZ SWALL:Q99TG7 (EMBL:AP003363) (373 aa) fasta scores: E(): 4.7e-13, 27.36% id in 391 aa. Possible alternative translational start site | genbank | 52208943 | CAH34882.1 | 450 | 1032616 | 1033968 | |
| Single chain protein id | Protein name | Protein type | Locus tag | Description / User comment | Database name | Database id | Genbank accession | Length | Start on contig / cds translation | End on contig / cds translation |
| 145658 | hypothetical | BPSL0891 | GntR family transcriptional regulator Similar to Pseudomonas aeruginosa probable transcriptional regulator pa3757 SWALL:Q9HXN8 (EMBL:AE004794) (247 aa) fasta scores: E(): 2.5e-56, 63.71% id in 248 aa, and to Xanthomonas campestris transcriptional regulator GntR family xcc3414 SWALL:AAM42684 (EMBL:AE012460) (255 aa) fasta scores: E(): 9.6e-47, 52.67% id in 243 aa | genbank | 52208944 | CAH34883.1 | 248 | 1034684 | 1035430 |