PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:78163 Links D2S2813 Homo sapiens chromosome 12, locus PIK3C2G Pan troglodytes chromosome 12, locus PIK3C2G Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTCCAACAGTAATCAGTGGGG Reverse primer: CCAATCATACTGCTGCCTCAT PCR product size: 164 (bp), Homo sapiens GenBank Accession: G14349    Homo sapiens Name: D2S2813 Also known as: GDB:733246 SHGC-8834 Polymorphism info:   Cross References Gene GeneID: 5288   Symbol: PIK3C2G   Description: phosphoinositide-3-kinase, class 2, gamma polypeptide   Position: 12p12 Mapping Information D2S2813 Sequence Map: Chr 12|HuRef Map Viewer   Position: 18487019-18487182 (bp)   D2S2813 Sequence Map: Chr 12 Map Viewer   Position: 18610334-18610497 (bp)   D2S2813 Sequence Map: Chr 12|Celera Map Viewer   Position: 23864581-23864744 (bp)   SHGC-8834 NCBI RH Map: Chr 12 Map Viewer   Position: 209.5 (cR)   Lod score: 2.46   SHGC-8834 Stanford-G3 Map: Chr 12 Map Viewer   Position: 979 (cR10000)   Lod score: F   Reference Interval: 24 Electronic PCR results Genomic (5 of 8)[Show All Hits] G14349.1 212 .. 375 (164 bp)   AC091815.7 53468 .. 53631 (164 bp)   CH003459.1 22274193 .. 22274356 (164 bp)   CH003507.1 19541862 .. 19542025 (164 bp)   CH471094.1 8979265 .. 8979428 (164 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC016899.4 120301 .. 120464 (164 bp)   AC017041.4 104981 .. 105144 (164 bp)     Whole Genome Shotgun sequences (4) AADD01122177.1 5882 .. 6045 (164 bp)   AADC01104106.1 114193 .. 114356 (164 bp)   AADB02014704.1 117690 .. 117853 (164 bp)   ABBA01067922.1 522505 .. 522668 (164 bp)        Pan troglodytes Name: D2S2813 Polymorphism info:   Cross References Gene GeneID: 465321   Symbol: PIK3C2G   Description: similar to PI3-kinase   Position:   Mapping Information D2S2813 Sequence Map: Chr 12 Map Viewer   Position: 19078317-19078480 (bp) Electronic PCR results Genomic (1) CM000326.1 19078317 .. 19078480 (164 bp)     Whole Genome Shotgun sequences (2) AADA01120891.1 3822 .. 3985 (164 bp)   AACZ02132520.1 20387 .. 20550 (164 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement