ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:50647 Links
D13S1167
Homo sapiens chromosome 13, locus FARP1
Macaca mulatta chromosome 17, locus FARP1
Pan troglodytes chromosome 13, locus FARP1

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:GCTTCACAAATGTCAATTTTATTG
Reverse primer:CAACAGCAACTCACAAATGC
PCR product size:249-250 (bp), Homo sapiens
GenBank Accession:G05976 Z39106

   Homo sapiens
Name: D13S1167
Also known as: GDB:588612 HSC0ZH082 WI-9529
Polymorphism info:  

Cross References Help
Gene GeneID:10160
 Symbol:FARP1
 Description:FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
 Position:13q32.2
UniGeneHs.403917 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)

Mapping InformationHelp
D13S1167 Sequence Map: Chr 13|HuRef Map Viewer
  Position: 79657394-79657644 (bp)
 
D13S1167 Sequence Map: Chr 13|Celera Map Viewer
  Position: 79906880-79907130 (bp)
 
D13S1167 Sequence Map: Chr 13 Map Viewer
  Position: 97857495-97857747 (bp)
 
WI-9529 NCBI RH Map: Chr 13 Map Viewer
  Position: 900.1 (cR)
  Lod score: 1.68
 
WI-9529 Whitehead-RH Map: Chr 13 Map Viewer
  Position: 268.0 (cR3000)
  Lod score: P0.00
 
WI-9529 GeneMap99-GB4 Map: Chr 13 Map Viewer
  Position: 280.35 (cR3000)
  Lod score: 1.45
  Reference Interval: D13S159-D13S280
 
WI-9529 Whitehead-YAC Map: Chr 13 Map Viewer
  Reference Interval: WC13.6

Electronic PCR results Help
mRNA (3)
AK025683.1 2205 .. 2455 (251 bp)  
AF339817.1 1229 .. 1478 (250 bp)  
BX537667.1 8000 .. 8250 (251 bp)  
 
Genomic (5 of 8)[Show All Hits]
G05976.1 1 .. 250 (250 bp)  
AL137249.29 13498 .. 13750 (253 bp)  
CH003460.1 79737307 .. 79737557 (251 bp)  
CH003508.1 84603605 .. 84603855 (251 bp)  
CH471085.1 12160081 .. 12160331 (251 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC022669.4 139488 .. 139740 (253 bp)  
 
ESTs (5 of 11)[Show All Hits]
Z39106.1 1 .. 250 (250 bp)  
H05284.1 17 .. 269 (253 bp)  
H05625.1 21 .. 278 (258 bp)  
H08750.1 17 .. 269 (253 bp)  
H09164.1 9 .. 260 (252 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01134769.1 60629 .. 60879 (251 bp)  
AADC01115516.1 60466 .. 60716 (251 bp)  
AADB02016010.1 5313994 .. 5314244 (251 bp)  
ABBA01027142.1 57040 .. 57290 (251 bp)  
 

   Macaca mulatta
Name: D13S1167
Polymorphism info:  

Cross References Help
Gene GeneID:701031
 Symbol:FARP1
 Description:FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
 Position: 

Mapping InformationHelp
D13S1167 Sequence Map: Chr 17 Map Viewer
  Position: 78783986-78784231 (bp)

   Pan troglodytes
Name: D13S1167
Polymorphism info:  

Cross References Help
Gene GeneID:452632
 Symbol:FARP1
 Description:FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)
 Position: 

Mapping InformationHelp
D13S1167 Sequence Map: Chr 13 Map Viewer
  Position: 99186163-99186416 (bp)

Electronic PCR results Help
Genomic (1)
CM000327.1 99186163 .. 99186416 (254 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01183404.1 22952 .. 23205 (254 bp)  
AACZ02144739.1 9557 .. 9810 (254 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement