ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:6341 Links
D7S2648
Homo sapiens chromosome 7, locus DNAJB9
Macaca mulatta chromosome 3, locus LOC701094
Pan troglodytes chromosome 7, locus DNAJB9

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:AATGTGGAAAAGTGCAGAAC
Reverse primer:CTGTTTGTAAAACCAGCCAG
PCR product size:125 (bp), Homo sapiens
GenBank Accession:T16768

   Homo sapiens
Name: D7S2648
Also known as: GDB:626204 NIB1821
Polymorphism info:  

Cross References Help
Gene GeneID:4189
 Symbol:DNAJB9
 Description:DnaJ (Hsp40) homolog, subfamily B, member 9
 Position:7q31|14q24.2-q24.3
UniGeneHs.6790 DnaJ (Hsp40) homolog, subfamily B, member 9
 Hs.700694 Transcribed locus

Mapping InformationHelp
D7S2648 Sequence Map: Chr 7|HuRef Map Viewer
  Position: 102582844-102582968 (bp)
 
D7S2648 Sequence Map: Chr 7|Celera Map Viewer
  Position: 103027998-103028122 (bp)
 
D7S2648 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer
  Position: 107581841-107581965 (bp)
 
D7S2648 Sequence Map: Chr 7 Map Viewer
  Position: 108001863-108001987 (bp)
 
NIB1821 NCBI RH Map: Chr 7 Map Viewer
  Position: 1105 (cR)
  Lod score: 2.52
 
NIB1821 Whitehead-RH Map: Chr 7 Map Viewer
  Position: 495.8 (cR3000)
  Lod score: P2.43
 
NIB1821 GeneMap99-GB4 Map: Chr 7 Map Viewer
  Position: 537.91 (cR3000)
  Lod score: 1.24
  Reference Interval: D7S2420-D7S523
 
NIB1821 Whitehead-YAC Map: Chr 7 Map Viewer
  Reference Interval: WC7.6

Electronic PCR results Help
RefSeq mRNA (1)
NM_012328.1 1704 .. 1828 (125 bp)  
 
mRNA (4)
AB026908.1 1704 .. 1828 (125 bp)  
BC028912.1 1685 .. 1809 (125 bp)  
AK092204.1 1729 .. 1853 (125 bp)  
AY359045.1 1524 .. 1648 (125 bp)  
 
Genomic (5 of 10)[Show All Hits]
AC005058.1 181453 .. 181577 (125 bp)  
BL000002.1 107702964 .. 107703088 (125 bp)  
CH003454.1 103487421 .. 103487545 (125 bp)  
CH003502.1 97765529 .. 97765653 (125 bp)  
CH236947.1 19904493 .. 19904617 (125 bp)  
 
ESTs (5 of 100)[Show All Hits]
T16768.1 54 .. 178 (125 bp)  
R24353.1 96 .. 220 (125 bp)  
R36599.1 110 .. 237 (128 bp)  
R39799.1 109 .. 233 (125 bp)  
R42820.1 108 .. 232 (125 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01084764.1 29717 .. 29841 (125 bp)  
AADC01070354.1 574300 .. 574424 (125 bp)  
AACC02000004.1 2846866 .. 2846990 (125 bp)  
AADB02010756.1 851076 .. 851200 (125 bp)  
ABBA01057890.1 103945 .. 104069 (125 bp)  
 

   Macaca mulatta
Name: D7S2648
Polymorphism info:  

Cross References Help
Gene GeneID:701094
 Symbol:LOC701094
 Description:similar to DnaJ (Hsp40) homolog, subfamily B, member 9
 Position: 
UniGeneMmu.3138 Similar to DnaJ (Hsp40) homolog, subfamily B, member 9

Mapping InformationHelp
D7S2648 Sequence Map: Chr 3 Map Viewer
  Position: 145987872-145987996 (bp)

   Pan troglodytes
Name: D7S2648
Polymorphism info:  

Cross References Help
Gene GeneID:744984
 Symbol:DNAJB9
 Description:DnaJ (Hsp40) homolog, subfamily B, member 9
 Position: 

Mapping InformationHelp
D7S2648 Sequence Map: Chr 7 Map Viewer
  Position: 108564096-108564220 (bp)

Electronic PCR results Help
RefSeq mRNA (3)
XM_001166449.1 1735 .. 1859 (125 bp)  
XM_001166484.1 1742 .. 1866 (125 bp)  
XM_001166520.1 2046 .. 2170 (125 bp)  
 
Genomic (3)
CM000321.1 108564096 .. 108564220 (125 bp)  
AC188797.2 3266 .. 3390 (125 bp)  
AC187526.3 148601 .. 148725 (125 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01274623.1 8412 .. 8536 (125 bp)  
AACZ02086866.1 3587 .. 3711 (125 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement