PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:36033 Links D10S1695 Primer Information Forward primer: CTAGTAAGACCTAGTAAGACCACCC Reverse primer: TACACTTTGAGACTTAGCCGTATC PCR product size: 233-287 (bp), Homo sapiens GenBank Accession: Z52978    Homo sapiens Name: D10S1695 Also known as: AFMa346zd5 GDB:608946 HSA346ZD5 SHGC-20597 stSG17454 Polymorphism info: on genetic map Cross References Mapping Information D10S1695 Sequence Map: Chr 10|HuRef Map Viewer   Position: 29065888-29066160 (bp)   D10S1695 Sequence Map: Chr 10|Celera Map Viewer   Position: 29112035-29112321 (bp)   D10S1695 Sequence Map: Chr 10 Map Viewer   Position: 29386446-29386728 (bp)   AFMa346zd5 Genethon Map: Chr 10 Map Viewer   Position: 56.20 (cM)   AFMa346zd5 Marshfield Map: Chr 10 Map Viewer   Position: 56.89 (cM)   AFMa346zd5 NCBI RH Map: Chr 10 Map Viewer   Position: 473.6 (cR)   Lod score: 1.51   SHGC-20597 Stanford-G3 Map: Chr 10 Map Viewer   Position: 1517 (cR10000)   Lod score: F   Reference Interval: 25   AFMa346zd5 GeneMap99-G3 Map: Chr 10 Map Viewer   Position: 1517 (cR10000)   Lod score: F   Reference Interval: D10S1684-D10S193   AFMa346zd5 GeneMap99-GB4 Map: Chr 10 Map Viewer   Position: 182.89 (cR3000)   Lod score: 0.15   Reference Interval: D10S1684-D10S193 Electronic PCR results Genomic (8) Z52978.1 71 .. 343 (273 bp)   AL355858.14 97960 .. 98242 (283 bp)   CH003457.1 29417297 .. 29417583 (287 bp)   CH003505.1 30430816 .. 30431101 (286 bp)   CH471072.2 29112035 .. 29112321 (287 bp)   CM000261.1 29112035 .. 29112321 (287 bp)   DS486039.1 1715817 .. 1716089 (273 bp)   CM000471.1 29065888 .. 29066160 (273 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AL355814.6 39249 .. 39531 (283 bp)   AC139489.1 35956 .. 36238 (283 bp)     Whole Genome Shotgun sequences (4) AADD01106168.1 6861 .. 7147 (287 bp)   AADC01089323.1 16464 .. 16749 (286 bp)   AADB02013021.1 1475754 .. 1476040 (287 bp)   ABBA01034370.1 26989 .. 27261 (273 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement