PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:7721 Links RH15722 Homo sapiens chromosome 13, locus FAM123A Pan troglodytes chromosome 13, locus LOC452495 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: ACAGAACATCAATGGTTTGGG Reverse primer: ACCGTTTATCCAGCTGTTAACA PCR product size: 134 (bp), Homo sapiens    Homo sapiens Name: RH15722 Also known as: stSG4126 Polymorphism info:   Cross References Gene GeneID: 219287   Symbol: FAM123A   Description: family with sequence similarity 123A   Position: 13q12.13 UniGene Hs.528335 Family with sequence similarity 123A   Hs.597391 Transcribed locus Mapping Information RH15722 Sequence Map: Chr 13 Map Viewer   Position: 24640731-24640864 (bp)   RH15722 Sequence Map: Chr 13|HuRef Map Viewer   Position: 6556756-6556889 (bp)   RH15722 Sequence Map: Chr 13|Celera Map Viewer   Position: 6806987-6807120 (bp)   stSG4126 NCBI RH Map: Chr 13 Map Viewer   Position: 10 (cR)   Lod score: 1.62   stSG4126 GeneMap99-GB4 Map: Chr 13 Map Viewer   Position: 69.65 (cR3000)   Lod score: 0.79   Reference Interval: D13S283-D13S221 Electronic PCR results RefSeq mRNA (2) NM_199138.1 2637 .. 2770 (134 bp)   NM_152704.2 2994 .. 3127 (134 bp)     mRNA (1) AL832627.1 1611 .. 1744 (134 bp)     Genomic (5 of 8)[Show All Hits] G60154.1 66 .. 199 (134 bp)   AL359757.21 138934 .. 139067 (134 bp)   CH003460.1 6350010 .. 6350143 (134 bp)   CH003508.1 6705546 .. 6705679 (134 bp)   CH471075.1 6542211 .. 6542344 (134 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) BX324168.8 245733 .. 245866 (134 bp)     ESTs (5 of 13)[Show All Hits] L13828.1 111 .. 244 (134 bp)   T34896.1 65 .. 198 (134 bp)   R42031.1 66 .. 199 (134 bp)   H28983.1 66 .. 199 (134 bp)   H92779.1 59 .. 192 (134 bp)     Whole Genome Shotgun sequences (4) AADD01130117.1 20317 .. 20450 (134 bp)   AADC01111770.1 4275 .. 4408 (134 bp)   AADB02015938.1 431433 .. 431566 (134 bp)   ABBA01007899.1 73415 .. 73548 (134 bp)        Pan troglodytes Name: RH15722 Polymorphism info:   Cross References Gene GeneID: 452495   Symbol: LOC452495   Description: hypothetical LOC452495   Position:   Mapping Information RH15722 Sequence Map: Chr 13 Map Viewer   Position: 24771765-24771898 (bp) Electronic PCR results RefSeq mRNA (3) XM_509590.2 3581 .. 3714 (134 bp)   XM_001154774.1 3012 .. 3145 (134 bp)   XM_001154833.1 3201 .. 3334 (134 bp)     Genomic (1) CM000327.1 24771765 .. 24771898 (134 bp)     Whole Genome Shotgun sequences (2) AADA01042944.1 6837 .. 6970 (134 bp)   AACZ02141506.1 18501 .. 18634 (134 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement