refSNP ID: rs3181795 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 105/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_004106.1:c.*229C>T NT_004487.18:g.11679317C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4403656 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3181795 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4403656 LEE|e15386 fwd/B C/T attctagtctcactctcttgtcccaccctt ttctcttccccattcccaactccagctaaa 04/26/02 10/10/03 105 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3181795|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=105 TGCTGTTTAC GGATATTTAT ATTCTAGTCT CACTCTCTTG TCCCACCCTT Y TTCTCTTCCC CATTCCCAAC TCCAGCTAAA ATATGGGAAG GGAGAACCCC   GeneView GeneView via analysis of contig annotation: FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_004487->NM_004106 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_004487->NM_004106-> 11679317 forward 515 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3181795 maps exactly once on NCBI human chromosome 1 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 1 NW_001838531.2 220545 132545912 minus G alt_assembly_8 HuRef HuRef view 50 1 NW_925683.1 11292940 134256114 plus C alt_assembly_1 Celera Celera view 50 1 NT_004487.18 11679317 159455586 plus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AI192567 Hs.743 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank HTGS Finished: GenBank HTGS Draft: GenBank STS: GenBank mRNA: NM_004106.1 AL590714.27 AL590651.4 G06422.1 M33195.1 UniGene Cluster ID 433300   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .