refSNP ID: rs1062383 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/T Ancestral Allele: Not available Clinical Association: unknown HGVS Names Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1548335 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1062383 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1548335 LEE|995490 fwd/T A/T aacgattgtctgcccatgtcctgcctgaaa accatgattgtttatggaaagtatctttaa 09/13/00 10/10/03 86 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1062383|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/T'|mol=cDNA|build=86 GAAAGTTGTT GTATACTGTT AACGATTGTC TGCCCATGTC CTGCCTGAAA W ACCATGATTG TTTATGGAAA GTATCTTTAA TAAAGCTGGA TACAGTTTGG   GeneView GeneView: no link established by analysis of contig annotation GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer: rs1062383 was not linked to the human genome 36.3 because it aligned to more than 2 locations on the genome. Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 1 NW_001838576.1 701505 25056683 plus T alt_assembly_8 HuRef HuRef view 50 1 NW_921351.1 1060475 25199617 plus T alt_assembly_1 Celera Celera view 50 1 NT_004610.18 9626748 26674993 plus T ref_assembly reference reference view 50 15 NW_925796.1 887826 7665292 plus T alt_assembly_1 Celera Celera view 50 15 NW_001838199.1 824012 7689287 plus T alt_assembly_8 HuRef HuRef view 50 15 NT_010194.16 814510 27811245 plus T ref_assembly reference reference view 50 16 NW_001838401.1 2574359 24134600 minus A alt_assembly_8 HuRef HuRef view 50 16 NW_926217.1 3339706 24819502 minus A alt_assembly_1 Celera Celera view 50 16 NT_010393.15 17356174 25950596 minus A ref_assembly reference reference view 50 2 NW_001838818.2 5811772 94970509 plus T alt_assembly_8 HuRef HuRef view 50 2 NW_928052.1 2965390 95411061 minus A alt_assembly_1 Celera Celera view 50 2 NT_022171.14 3276028 100572875 minus A ref_assembly reference reference view 50 5 NW_001838951.1 4826655 70744764 minus A alt_assembly_8 HuRef HuRef view 50 5 NW_922729.1 4830566 71430722 minus A alt_assembly_1 Celera Celera view 50 5 NT_006713.14 26131439 75572837 minus A ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AW001372 Hs.181163 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): NM_005517.3 XM_001125913.1 XM_001127272.1 XM_001132219.1 UniGene Cluster ID 181163   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .