PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:3839 Links D1S2572 Homo sapiens chromosome 1, locus CAP1 Pan troglodytes chromosome 1, locus CAP1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AAGAGACCTTGAGCCCATAG Reverse primer: CAGCTCTTCTTGCTACTCCA PCR product size: 111 (bp), Homo sapiens GenBank Accession: G07652    Homo sapiens Name: D1S2572 Also known as: GDB:598171 SHGC-5843 Polymorphism info:   Cross References Gene GeneID: 10487   Symbol: CAP1   Description: CAP, adenylate cyclase-associated protein 1 (yeast)   Position: 1p34.2 Mapping Information D1S2572 Sequence Map: Chr 1|HuRef Map Viewer   Position: 38636984-38637094 (bp)   D1S2572 Sequence Map: Chr 1|Celera Map Viewer   Position: 38801225-38801335 (bp)   D1S2572 Sequence Map: Chr 1 Map Viewer   Position: 40291533-40291643 (bp)   SHGC-5843 NCBI RH Map: Chr 1 Map Viewer   Position: 290.2 (cR)   Lod score: 2.13   SHGC-5843 TNG Map: Chr 1 Map Viewer   Position: 19362 (cR50000)   Lod score: 3.3   Reference Interval: 41   SHGC-5843 Stanford-G3 Map: Chr 1 Map Viewer   Position: 2120 (cR10000)   Lod score: F   Reference Interval: 27 Electronic PCR results Genomic (5 of 7)[Show All Hits] G07652.1 72 .. 182 (111 bp)   AL512599.33 16264 .. 16374 (111 bp)   CH003448.1 39764984 .. 39765094 (111 bp)   CH471059.2 14662083 .. 14662193 (111 bp)   CM000252.1 38801225 .. 38801335 (111 bp)     Whole Genome Shotgun sequences (3) AADD01003072.1 2801 .. 2911 (111 bp)   AADB02000461.1 106327 .. 106437 (111 bp)   ABBA01023190.1 21393 .. 21503 (111 bp)        Pan troglodytes Name: D1S2572 Polymorphism info:   Cross References Gene GeneID: 746432   Symbol: CAP1   Description: CAP, adenylate cyclase-associated protein 1 (yeast)   Position:   Mapping Information D1S2572 Sequence Map: Chr 1 Map Viewer   Position: 40692736-40692846 (bp) Electronic PCR results Genomic (1) CM000314.1 40692736 .. 40692846 (111 bp)     Whole Genome Shotgun sequences (2) AADA01359380.1 5951 .. 6061 (111 bp)   AACZ02004269.1 7004 .. 7114 (111 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement