PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:74074 Links D9S2051 Homo sapiens chromosome 9, locus ROR2 Macaca mulatta chromosome 15, locus ROR2 Pan troglodytes chromosome 9, locus ROR2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TGGTAGTGAGCAGCAAATGC Reverse primer: TTTTGCAGGCCCTTATTCC PCR product size: 104 (bp), Homo sapiens GenBank Accession: G13587 M97639    Homo sapiens Name: D9S2051 Also known as: GDB:739610 GDB:741496 SHGC-11222 Polymorphism info:   Cross References Gene GeneID: 4920   Symbol: ROR2   Description: receptor tyrosine kinase-like orphan receptor 2   Position: 9q22 UniGene Hs.98255 Receptor tyrosine kinase-like orphan receptor 2 Mapping Information D9S2051 Sequence Map: Chr 9|HuRef Map Viewer   Position: 64163709-64163812 (bp)   D9S2051 Sequence Map: Chr 9|Celera Map Viewer   Position: 64922452-64922555 (bp)   D9S2051 Sequence Map: Chr 9 Map Viewer   Position: 93525374-93525477 (bp)   SHGC-11222 NCBI RH Map: Chr 9 Map Viewer   Position: 769.7 (cR)   Lod score: 1.66   SHGC-11222 Stanford-G3 Map: Chr 9 Map Viewer   Position: 3061 (cR10000)   Lod score: F   Reference Interval: 38   SHGC-11222 GeneMap99-G3 Map: Chr 9 Map Viewer   Position: 2959 (cR10000)   Lod score: F   Reference Interval: D9S1842-D9S196 Electronic PCR results RefSeq mRNA (1) NM_004560.2 3319 .. 3422 (104 bp)     mRNA (3) M97639.1 3319 .. 3422 (104 bp)   AB209154.1 3584 .. 3687 (104 bp)   BC130522.1 3203 .. 3306 (104 bp)     Genomic (5 of 8)[Show All Hits] G13587.1 288 .. 391 (104 bp)   AL928802.7 20944 .. 21047 (104 bp)   CH003456.1 62365416 .. 62365519 (104 bp)   CH003504.1 68828619 .. 68828722 (104 bp)   CH471089.1 23302488 .. 23302591 (104 bp)     ESTs (5 of 7)[Show All Hits] AA132165.1 232 .. 336 (105 bp)   BI524657.1 645 .. 751 (107 bp)   BM127004.1 51 .. 154 (104 bp)   BM127703.1 50 .. 153 (104 bp)   BU631248.1 460 .. 563 (104 bp)     Whole Genome Shotgun sequences (4) AADD01101123.1 4682 .. 4785 (104 bp)   AADC01084627.1 1839 .. 1942 (104 bp)   AADB02012656.1 4682 .. 4785 (104 bp)   ABBA01018577.1 11057 .. 11160 (104 bp)        Macaca mulatta Name: D9S2051 Polymorphism info:   Cross References Gene GeneID: 715482   Symbol: ROR2   Description: receptor tyrosine kinase-like orphan receptor 2   Position:   UniGene Mmu.14391 Receptor tyrosine kinase-like orphan receptor 2 Mapping Information D9S2051 Sequence Map: Chr 15 Map Viewer   Position: 103545899-103546002 (bp)    Pan troglodytes Name: D9S2051 Polymorphism info:   Cross References Gene GeneID: 464589   Symbol: ROR2   Description: receptor tyrosine kinase-like orphan receptor 2   Position:   Mapping Information D9S2051 Sequence Map: Chr 9 Map Viewer   Position: 90909711-90910066 (bp) Electronic PCR results RefSeq mRNA (1) XM_520126.2 3135 .. 3238 (104 bp)     Genomic (1) CM000323.1 90909711 .. 90910066 (356 bp)     Whole Genome Shotgun sequences (2) AADA01258249.1 4573 .. 4928 (356 bp)   AACZ02105282.1 17708 .. 18063 (356 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement