ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:25826 Links
D19S407
Homo sapiens chromosome 19, loci ZNF257 and LOC100128975
Macaca mulatta chromosome 19, locus LOC720434
Pan troglodytes chromosome 19, locus ZNF208

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:CAGATCACACCATTGCACTC
Reverse primer:AAGGCTAATATTAAGCCTGCA
PCR product size:129 (bp), Homo sapiens
GenBank Accession:Z23636

   Homo sapiens
Name: D19S407
Also known as: AFM214yf6 SHGC-3639 stSG933
Polymorphism info:  

Cross References Help
Gene GeneID:100128975
 Symbol:LOC100128975
 Description:similar to Zinc finger protein 626
 Position:19p12
Gene GeneID:113835
 Symbol:ZNF257
 Description:zinc finger protein 257
 Position:19q13

Mapping InformationHelp
D19S407 Sequence Map: Chr 19|HuRef Map Viewer
  Position: 19627280-19627410 (bp)
 
D19S407 Sequence Map: Chr 19 Map Viewer
  Position: 19926283-19926413 (bp)
 
D19S407 Sequence Map: Chr 19|Celera Map Viewer
  Position: 19970670-19970800 (bp)
 
D19S407 Sequence Map: Chr 19|HuRef Map Viewer
  Position: 21778033-21778524 (bp)
 
D19S407 Sequence Map: Chr 19 Map Viewer
  Position: 22031979-22032470 (bp)
 
D19S407 Sequence Map: Chr 19|Celera Map Viewer
  Position: 22072390-22072881 (bp)
 
SHGC-3639 NCBI RH Map: Chr 19 Map Viewer
  Position: 183.7 (cR)
  Lod score: 3.20
 
SHGC-3639 TNG Map: Chr 19 Map Viewer
  Position: 7350 (cR50000)
  Lod score: 12
  Reference Interval: 26
 
SHGC-3639 Stanford-G3 Map: Chr 19 Map Viewer
  Position: 751 (cR10000)
  Lod score: F
  Reference Interval: 9
 
AFM214yf6 GeneMap99-G3 Map: Chr 19 Map Viewer
  Position: 751 (cR10000)
  Lod score: F
  Reference Interval: D19S407-D19S222
 
AFM214yf6 GeneMap99-GB4 Map: Chr 19 Map Viewer
  Position: 110.54 (cR3000)
  Lod score: F
  Reference Interval: D19S407-D19S222

Electronic PCR results Help
Genomic (5 of 15)[Show All Hits]
Z23636.1 230 .. 358 (129 bp)  
AC007204.1 62103 .. 62233 (131 bp)  
AC011482.4 102487 .. 102978 (492 bp)  
CH003466.1 20127817 .. 20127943 (127 bp)  
CH003466.1 22225222 .. 22225713 (492 bp)  
 
Whole Genome Shotgun sequences (5 of 8)[Show All Hits]
AADD01164265.1 1327 .. 1818 (492 bp)  
AADD01164097.1 29888 .. 30014 (127 bp)  
AADC01138388.1 21185 .. 21676 (492 bp)  
AADC01137987.1 19137 .. 19267 (131 bp)  
AADB02020103.1 173481 .. 173972 (492 bp)  
 

   Macaca mulatta
Name: D19S407
Polymorphism info:  

Cross References Help
Gene GeneID:720434
 Symbol:LOC720434
 Description:similar to zinc finger protein 91
 Position: 

Mapping InformationHelp
D19S407 Sequence Map: Chr 19 Map Viewer
  Position: 19835689-19835796 (bp)

   Pan troglodytes
Name: D19S407
Polymorphism info:  

Cross References Help
Gene GeneID:468778
 Symbol:ZNF208
 Description:zinc finger protein 208
 Position: 

Mapping InformationHelp
D19S407 Sequence Map: Chr 19 Map Viewer
  Position: 20456108-20456244 (bp)

Electronic PCR results Help
Genomic (2)
CM000333.1 20456108 .. 20456244 (137 bp)  
CM000333.1 22329044 .. 22329536 (493 bp)  
 
Whole Genome Shotgun sequences (3)
AADA01278060.1 1813 .. 2305 (493 bp)  
AACZ02183796.1 36293 .. 36785 (493 bp)  
AACZ02183659.1 4733 .. 4869 (137 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement