refSNP ID: rs11551204 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 120/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_014462.1:c.299G>A NP_055277.1:p.R100K NT_007995.14:g.8341679C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss16252270 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs11551204 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss16252270 CGAP-GAI|1503879 fwd/B C/T tctgcttccagcttggtctgctgttccacc tttgttcttctagaatttcttcaatggata 11/18/03 11/22/03 120 cDNA unknown ss75215517 ILLUMINA|ILMN_Human_1M_rs11551204 fwd/B C/T tctgcttccagcttggtctgctgttccacc tttgttcttctagaatttcttcaatggata 08/28/07 08/29/07 129 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs11551204|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=129 GGGCCTGCAC TTTCAACTTC TCTGCTTCCA GCTTGGTCTG CTGTTCCACC Y TTTGTTCTTC TAGAATTTCT TCAATGGATA CTTGCTGGAG GGGTGTGTCA   GeneView GeneView via analysis of contig annotation: LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_007995->NM_014462 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_007995->NM_014462->NP_055277 8341680 reverse 487 missense A Lys [K] 2 100 contig reference G Arg [R] 2 100 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs11551204 maps exactly once on NCBI human chromosome 8 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 8 NW_001839128.2 754798 36556208 minus G alt_assembly_8 HuRef HuRef view 50 8 NW_923907.1 25541665 36973827 plus C alt_assembly_1 Celera Celera view 50 8 NT_007995.14 8341680 38140448 plus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank BQ130896 BI518053 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_014462.1 AF000177.1 AJ238094.1 BC001767.1 UniGene Cluster ID 425311   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source C/C HWP C ss16252270 HapMap-CEU European 116 IG 1.000 1.000 HapMap-HCB Asian 88 IG 1.000 1.000 HapMap-JPT Asian 84 IG 1.000 1.000 HapMap-YRI Sub-Saharan African 116 IG 1.000 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 270 210 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .