The largest concentrations of HA are found within the skin and musculo-skeletal system which account for >50% of total body HA. Here the rate of HA turnover is rapid (t_1/2 0.5 d) by comparison with other extracellular matrix components (26). Surprisingly, most degradation does not occur within the skin itself; rather HA is transported through the lymphatic system to distant lymph nodes where >90% of the glycosaminoglycan in afferent lymph is degraded or reenters the circulation to be rapidly endocytosed by liver endothelial HA receptors (11, 12). Hence, the lymphatic vessels are a major conduit for HA transport from tissues such as the skin and intestine, where flux measurements indicate they can remove as much as 10% of the total HA content within a 24-h period (36). This turnover can be further increased after either tissue injury or sepsis. Yet why HA should require transport through the lymphatics is not presently understood and little or nothing is known about the nature of any HA-binding molecules involved.

The majority of HA-binding proteins within the tissues belong to the Link protein superfamily. Members of this superfamily contain a conserved disulfide linked domain of ~100 amino acid residues termed the Link module, which binds the minimal recognition unit HA_6–8 and whose three-dimensional structure resembles the sugar-binding domain of C-type lectins. Other superfamily members in addition to the Link protein (34) include the large matrix proteoglycans Aggrecan (9), Versican (61), and Brevican (58), the tumor necrosis factor–inducible protein TSG-6 (28), and a single cell surface HA receptor, the CD44 molecule (1, 40). CD44 is widely expressed on epithelial, mesenchymal, and lymphoid cells, where it is thought to constitute the major receptor for HA (reviewed in 29). Interactions between CD44 and HA are implicated in several diverse functions including the maintenance of tissue structure within the epithelia (57), the extravasation of lymphocytes through inflamed vascular endothelium (8, 33), and the hematogenous dissemination of tumor cells (46, 47). The only other HA receptors characterized to date are RHAMM (receptor for HA-mediated motility), a 58-kD intracellular protein expressed transiently on the surface of transformed lymphocytes (15, 53), the cation-dependent liver endothelial cell (LEC) receptors responsible for the clearance of HA from the serum (59, 60), and the nuclear protein cdc37 (14). To date, however, there is no specific evidence that either CD44, RHAMM, or the LEC HA receptors are involved in the sequestration or transport of HA by lymphatic vessels, or in its uptake or degradation within the lymph nodes. Indeed, deletion of the CD44 gene in knockout mice produced no significant abnormalities, and resulted in no significant disruption of lymphatic function (43). Hence the identities of HA receptors involved in lymphatic HA homeostasis are completely unknown and we understand little about the regulation of this important physiological process.

Here we present the first identification of an HA receptor that is almost exclusively expressed on lymph vessels and is absent from blood vessels. This novel receptor which we have named LYVE-1 is a homologue of the CD44 HA receptor and a new member of the Link protein superfamily. We present evidence that LYVE-1 sequesters HA on lymph vessel endothelium in vivo and highlight the significance of this novel receptor in further defining the structure and function of the lymphatic system.

First-strand cDNA syntheses were carried out by oligo-dT priming in 50-μl reactions containing 5 μg total RNA, 0.5 μM dNTPs, 0.1 M Tris-HCl, pH 8.3, and 2.5 mU AMV reverse transcriptase for 3 h at 42°C. Samples (1 μl) of the final products were then committed to 50-μl PCR reactions (94°C, 1 min; 55°C, 1 min; 72°C, 1 min; 40 cycles) containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl₂, 1 mM dNTPs, 1 U Taq DNA polymerase, and the LYVE-1 primers LYVE-1F Hind/LYVE-1R Bam (see below), or the CD44 primers AMP1 (TCCCAGTATGACACATATTGC) and AMP2 (CCAAGATGATCAGCCATTCTGG). The integrity of the cDNA and input RNA was confirmed by PCR with the glyceraldehyde-3-phosphate dehydrogenase primers G3PF (TGGTCGTATTGGGCGCCTGG) and G3PR (CCAAATTCGTTGTCATACCAGG). Products were electrophoresed on 1.25% agarose gels, transferred to charged nylon membranes (Hybond N; Amersham International plc), and hybridized with ³²P-end-labeled oligonucleotide probes to detect either LYVE-1 (CGCGGATCCCCATAAAAACTTCTGTGACAC) or CD44 (TGTACATCAGTCACAGACCTGCA). Blots were washed at 55°C in 6× SSC for 10 min before autoradiography.

For biosynthetic labeling of LYVE-1 Fc fusion proteins, transiently transfected COS 1 cells were cultured (24 h, 37°C) in RPMI supplemented with 100 μCi/ml [³⁵S]methionine/cysteine (Amersham International plc) followed by absorption of the labeled fusion proteins from the supernatants on protein A–Sepharose beads. Beads were then boiled in SDS-PAGE sample buffer and electrophoresed on 10% polyacrylamide SDS-PAGE gels. After electrophoresis, the gels were fixed, stained with Coomassie blue, and impregnated with AMPLIFY (Amersham International plc), before drying and exposing to Kodak X-Omat x-ray film at −70°C.

Binding to Immobilized HA. Binding of LYVE-1 IgFc fusion protein to immobilized HA was measured in a 96-well microtiter plate ELISA assay. In brief, microtiter plates (Nunc Maxisorp) were coated with HA (purified from rooster comb; Sigma) at a concentration of 2 mg/ml in coating buffer (15 mM sodium carbonate and 34 mM sodium bicarbonate, pH 9.3). After overnight incubation at 25°C, blocking (2 h) in PBS, pH 7.5, 0.25% (wt/ vol) BSA, 0.05% (wt/vol) Tween 20, and washing (three times, PBS, pH 7.5), plates were incubated with purified LYVE-1 IgFc or CD44H Fc, or with the control proteins ICAM-2 Fc or CD33 Fc (15–500 ng/well) for 1 h at 25°C. After removal of unbound protein by washing (three times) with PBS, bound fusion protein was detected by successive (1 h, 25°C) incubation with horseradish peroxidase–conjugated anti–human IgG₁ antibody. Reactions were developed by the addition of O-phenylenediamine substrate and the absorbance measured at 490 nm in a Bio-Rad microplate reader. To determine the binding specificity of LYVE-1 for other glycosaminoglycans, the standard assay was modified to include either free chondroitin-4 sulfate, chondroitin-6 sulfate, or heparin (1.5–200 μg/ml) as competitor during the primary incubation step.

Binding to Soluble HA. For binding assays with soluble HA, this was first biotinylated by a modification of the method of Yu and Toole (33). In brief, high molecular weight HA (5 mg/ml) in 0.1 M MES, pH 5.5, was derivatized with biotin-LC-hydrazide (1 mM) in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDAC, 0.16 mg/ml) in 1-ml stirred reactions overnight at room temperature, followed by dialysis against PBS, pH 7.5, to remove free biotin.

To perform the standard binding assay, microtiter plates were coated with LYVE-1 Fc, CD44H Fc, or the control fusion proteins CD33 Fc or ICAM-2 Fc (1.25–10 μg/ml, 1 h, 25°C) washed (three times) to remove unbound material, and incubated with biotinylated HA (5 μg/ml) for a further 1 h. Bound HA was then detected by incubation with horseradish peroxidase–conjugated streptavidin (Sigma) and O-phenylenediamine substrate. Absorbances were measured at 490 nm in a Bio-Rad microplate reader as described above.

Sandwich Assay for Binding to Preformed HA Receptor Complexes. To measure binding of LYVE-1 to HA presented as a complex with CD44, microtiter plates were coated with bacterially expressed CD44^158his (5 μg/ml), before successive incubations with HA (250 μg/ml) and either LYVE-1 (5 μg/ml) or CD33 Fc (5 μg/ml, negative control), followed by detection with peroxidase-conjugated anti–human IgFc (see above). To measure binding of CD44 to HA presented as a complex with LYVE-1, microtiter plates were coated with either LYVE-1 Fc or CD33 Fc (negative control), before successive incubations with HA (250 μg/ml) and CD44H Fc (5 μg/ml) and detection with the peroxidase-conjugated CD44 mAb A3D8 (1 μg/ml).

For standard single/double immunofluorescent staining, tissue sections on glass microscope slides were dewaxed and rehydrated as described above before incubation (30 min, 5°C) with 1:100 diluted LYVE-1 serum in PBS, 5% human serum, 0.1% azide, either alone or in combination with 1:2 diluted CD31, CD34, or vWF hybridoma supernatants, or with CD44 mAb (10 μg/ml). After washing (twice) to remove unbound antibodies, samples were then stained (30 min, 5°C) with 1:25 diluted FITC-conjugated goat anti–rabbit Ig (to detect LYVE-1), either alone or in combination with 1–50 diluted Texas red–conjugated goat anti–rabbit Ig. Samples were fixed in 2% (wt/vol) formaldehyde and viewed under a Zeiss Axioskop fluorescence microscope using epifluorescent illumination.

Staining for HA and colocalization with LYVE-1 receptor was carried out using complexes of biotinylated bovine aggrecan G1 domain and bovine link protein as described previously (48). In brief, dewaxed and rehydrated tissue sections on glass microscope slides were blocked (30 min, room temperature) in PBS, pH 7.5, containing 50 mM glycine and 1% (wt/ vol) fat-free milk powder, before incubation (overnight, 5°C) with bHABC (5 μg/ml) with or without LYVE-1 serum (1:100 dilution) in 0.1 M sodium phosphate buffer, pH 7.4, supplemented with 1% BSA. After washing to remove unbound reagents, the sections were incubated (1 h, room temperature) with a mixture of Texas red–labeled anti–rabbit Ig and FITC-labeled avidin (Vector Laboratories, Inc.), diluted 1:50 and 1:500, respectively, in PBS, pH 7.5. Slides were mounted in Vectashield (Vector Laboratories, Inc.) for immunofluorescence microscopy.

Figure 1 Nucleotide sequence and derived amino acid sequence of LYVE-1, a novel human HA receptor. A shows the complete nucleotide and derived amino acid sequence for the 2,313-bp LYVE-1 cDNA clone in pBluescript. A cleavable NH2-terminal leader predicted (more ...)

Figure 2 Comparison of the LYVE-1 receptor Link module with other Link superfamily members. In A, the derived amino acid sequence of LYVE-1 (top line) is shown aligned with that of the full-length human CD44 cDNA (bottom line) using the GCG program GAP. Positions (more ...)

The presence of the LYVE-1 Link module is more clearly illustrated by sequence alignments with other human Link superfamily members including the cartilage matrix proteins Aggrecan, Versican, and Link protein itself, each of which contain tandem repeats of the Link homology unit (Fig. 2 B). A novel feature apparent from these alignments is that LYVE-1 and CD44 appear to define a subgroup within the Link superfamily. These findings suggest the divergence of the cell surface HA receptors as a separate branch from the HA-binding extracellular matrix proteins during evolution.

More detailed comparisons of individual amino acid residues within the putative HA-binding regions of the LYVE-1 and CD44 Link modules reveal a number of differences. For example, of the nine key residues identified by site directed mutagenesis (2, 37) as critical for HA binding within the human CD44 Link domain, Lys 38 + 68, Arg 41 + 78, Tyr 42, 79, + 105, and Asp 100 + 101, only three of these, Lys 38, Tyr 79, and Asp 100 are conserved within the LYVE-1 molecule (residues 46, 87, and 109, respectively, Fig. 2 A). Furthermore, the peripheral cluster of basic amino acids located downstream of the Link module in CD44, which includes Arg 158 and Lys 162 (Fig. 2 A) previously shown to be important for HA binding (37), is not conserved in the LYVE-1 sequence. Hence, despite overall similarities in Link module sequences, the specific residues involved in the predicted LYVE-1–carbohydrate interaction are likely to be different from those in the CD44 molecule.

Figure 3 Cell surface expression of LYVE-1 receptor on transfected COS cells. In A, COS 1 cells were transiently transfected with either full-length LYVE-1 cDNA in the expression vector pRcCMV (a and b), or with a control empty pRcCMV vector (c and d) using DEAE (more ...)

Figure 4 LYVE-1 binds both immobilized and soluble HA. LYVE-1, expressed as a soluble IgFc fusion protein in transiently transfected human COS fibroblasts, was compared with CD44 for binding to HA and other glycosaminoglycans. A shows LYVE-1 and CD44H Fc fusion (more ...)

Comparison of LYVE-1 Fc with CD44 Fc in a microtiter plate glycosaminoglycan binding assay (Fig. 4, B and C) revealed that LYVE-1 binds immobilized HA in a concentration-dependent manner that is similar if not identical to CD44. In contrast, neither of the two control fusion proteins CD33 Fc or ICAM-2 Fc displayed any significant binding over this range (0.25–10 μg/ml). The specificity of the LYVE-1 HA interaction was demonstrated by competition with free glycosaminoglycans, which showed that neither chondroitin-4-SO₄, chondroitin-6-SO₄, nor heparan sulfate blocked binding even at concentrations up to 200 μg/ml (Fig. 4 C). In contrast the LYVE-1 HA interaction was extremely sensitive to inhibition by free HA (IC₅₀ ~3 μg/ml). This indicates that LYVE-1 has a much higher specificity for glycosaminoglycan binding than either CD44 or the cation-dependent liver endothelial receptors. Importantly, this also distinguishes LYVE-1 from the lymph node receptors involved in the uptake and degradation of lymph fluid HA, since these are blocked by chondroitin sulfate and chondroitin sulfate proteoglycans (54). LYVE-1 Fc also bound soluble high molecular mass HA in a concentration-dependent fashion (Fig. 4 D), although the binding capacity decreased dramatically with increasing levels of HA biotinylation (data not shown), a feature that was not observed with CD44. This latter result suggests there is a significant difference in the size or geometry of the HA-binding surface within these two receptors.

Figure 5 Northern blot hybridization analysis of LYVE-1 receptor mRNA. RNA blots containing 2 μg poly(A)+ RNA per lane from each of the tissues shown were hybridized to a 32P-labeled full-length LYVE-1 DNA probe (top), or glyceraldehyde-3-phosphate (more ...)

Intriguingly, RT-PCR analyses (Fig. 6) of individual cell lines derived from lymphocytes, myeloid cells, monocytes, microvascular endothelial cells, and fibroblasts yielded no products in any cell type with the exception of late passage HUVEC, and placental tissue, used as a positive control. In contrast, each cell line yielded abundant PCR products when amplified with primers to CD44, or the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase. These results suggested an unusually specific pattern of tissue expression for LYVE-1 that was clearly distinct from that of the CD44 molecule.

Figure 6 RT-PCR analysis of LYVE-1 mRNA expression in tissue culture cell lines. LYVE-1 and CD44 mRNA levels were compared within a panel of tissue culture cell lines representing different lineages. Samples of cDNA prepared from each of the cell lines shown (more ...)

Figure 7 Specificity of a LYVE-1 receptor polyclonal serum. The specificity of an affinity-purified rabbit polyclonal antiserum generated against soluble LYVE-1 receptor and its capacity to block HA binding were assessed in microtiter plate binding assays. (more ...)

Immunoperoxidase staining of human tissues with the polyclonal LYVE-1 serum revealed an unusual and highly restricted expression pattern, as shown in Fig. 8 and summarized in Table I. Intriguingly the expression of LYVE-1 was mostly confined to endothelial cells lining vessels of the lymphatic system. The only other sites of prominent LYVE-1 expression were sinusoidal endothelial cells within the spleen and placental syncytiotrophoblasts (Table I and Fig. 8 k). In contrast with the expression pattern of CD44, no LYVE-1 was detected on lymphocytes or other hematopoietic cells within lymphoid organs such as the tonsil and thymus (Table I and Fig. 8 l). Localization of LYVE-1 within the lymphatics was most strikingly visible among the draining lymphatic vessels within the submucosae, underlying the intestinal crypts in colon and small intestine (Fig. 8, a–d). Many small lymph vessels, including some containing large numbers of lymphocytes, showed intense endothelial staining. High levels of LYVE-1 expression were also apparent on the lacteal vessels draining individual intestinal villi, on subdermal lymphatic vessels within the skin, and on lymphatic vessels within peripheral nodes (Fig. 8, e–j). A similar expression pattern was found in other tissues displaying prominent lymphatics, particularly the appendix and stomach (see Table I). In contrast, no LYVE-1 was detected on blood vessels within any of the tissues tested. Interestingly, LYVE-1 protein expression was detected on the surface of cultured HUVEC (Fig. 8 m), confirming the detection of LYVE-1 mRNA by RT-PCR (see above). This is most likely to be the result of culture induced de-differentiation as no vascular staining was observed in tissue sections of umbilical vein (not shown). The selectivity for lymphatic expression is underlined by a comparison of the two vessel types in sections of salivary gland (Fig. 8 g), where blood vessels that are clearly distinguishable by their erythrocyte content (visible through weak nonspecific staining with rabbit IgG) are negative for LYVE-1, while the adjacent empty lymph vessels stain intensely. This distinction was confirmed by double immunofluorescence staining of small intestine sections (Fig. 9) with antibodies to LYVE-1 and to the vascular endothelial markers CD34 (sgp90) and vWF (Factor VIII–related molecule). LYVE-1 staining was mutually exclusive with both of the other markers, and was confined to irregularly shaped vessels within the submucosae that were devoid of erythrocytes. Furthermore, double immunofluorescence staining revealed little or no CD44 expression on lymphatic vessels, indicating that LYVE-1 is likely to be the major receptor for HA on lymphatic endothelial cells (Fig. 9).

Figure 8 Localization of the LYVE-1 HA receptor in human tissues. Paraffin-embedded human tissue sections were stained with rabbit polyclonal LYVE-1 antiserum (1:100 dilution), followed by peroxidase-conjugated goat anti–rabbit IgG as described in Materials (more ...)

Table I Tissue Distribution of the LYVE-1 Molecule

Figure 9 Immunofluorescent staining of LYVE-1 in lymphatic vessels and colocalization with HA. Sections of human small intestine were double stained for LYVE-1, CD44, the vascular endothelial molecules CD34 and vWF, and for HA, by indirect immunofluorescence (more ...)

Finally, we looked for evidence that leukocytes adhere to HA presented by LYVE-1 present on the lymph vessel wall. Our initial attempts to demonstrate such adhesion using CD44 transfected Namalwa B lymphoma cells and frozen sections of gut lymphatics in Stamper-Woodruff type assays were difficult to interpret, because of the high levels of binding to HA within the surrounding parenchyma (not shown). As an alternative, we tested the ability of LYVE-1 Fc immobilized on plastic microtiter dishes to support HA-mediated binding to CD44. As shown in Fig. 10, LYVE-1 indeed supported HA-mediated binding of CD44, regardless of the order used for primary presentation or secondary HA binding. In conclusion, our results indicate that LYVE-1, in addition to binding HA within the lymphatics, may also bind HA-coated lymphocytes in transit to the lymph nodes.

Figure 10 LYVE-1 molecules support HA-mediated binding to CD44. The capacity of LYVE-1 and CD44 to form ternary complexes with HA was tested using a modification of the HA-binding assay in Fig. 4 B. A shows binding of LYVE-1 Fc and CD33 Fc (control) to HA, presented (more ...)

The interaction between cells and extracellular matrix HA is clearly of fundamental importance both during embryonic limb development and in processes such as wound healing and inflammation in later adult life (19–22). Such importance predicts that many receptors must be involved in HA adhesion, and that complex mechanisms must exist to regulate both their expression and their ligand-binding affinity. Yet at present, the list of professional cell surface HA receptors is small and includes only the CD44 molecule, RHAMM, and the LEC HA receptors. Furthermore, deletion of the gene for CD44, the most abundant and widely expressed of these, has little if any deleterious effects on the embryo (43). Thus, it has become increasingly clear to many workers in the field that additional receptors for HA are likely to exist within the genome.

In this paper we have described the primary structure and biological function of one such receptor, termed LYVE-1, which is present within vessels of the lymphatic system. This new receptor is a type I integral membrane polypeptide whose extracellular domain encodes a single cartilage Link module, the prototypic HA-binding domain conserved within all members of the Link or hyaladherin superfamily (51). The central core of the LYVE-1 Link module (C2-C3) is 57% identical to that of the human CD44 HA receptor, the only other Link superfamily HA receptor to be described to date and the closest homologue of LYVE-1. Nevertheless, there are distinct differences between LYVE-1 and CD44 that suggest the two homologues differ either in the mode of HA binding or in its regulation.

Firstly, in terms of HA binding, only three of nine residues identified as essential within the CD44 Link module are conserved in LYVE-1 (Lys 38, Tyr 79, and Asp 100) and none of the downstream COOH-terminal basic residues of CD44 are present. Furthermore, unlike CD44, the affinity of LYVE-1 for bHA is drastically reduced with increasing degrees of biotinylation. These features suggest HA is orientated differently within the LYVE-1 Link module and suggest it may bind a larger HA unit than the minimal HA₆ unit bound by CD44 (18, 55). Competition experiments with defined HA fragment sizes will be required to distinguish between these possibilities. A further distinction between LYVE-1 and CD44 is their dramatic difference in substrate specificity. Unlike CD44, LYVE-1 displays exquisite specificity for binding HA and no affinity for the glycosaminoglycans chondroitin-4 sulfate, chondroitin-6 sulfate, or heparan sulfate. This remarkable ligand specificity also distinguishes LYVE-1 from the lymph node HA receptors which mediate the uptake and degradation of HA from afferent lymph, a process that is blocked by chondroitin sulfate and chondroitin sulfate proteoglycans (54).

Secondly, the regulation of HA binding and its functional consequences are likely to differ significantly from CD44. Excluding the Link domain and its immediate boundaries, the LYVE-1 extracellular domain, transmembrane anchor, and cytoplasmic tail bear no similarity to those of the CD44 molecule. In the CD44 ectodomain, alternative splicing of up to 10 exons within the membrane-proximal region regulates HA binding in some cell types (5, 44), and introduces new ligand-binding specificities (4, 17). Although we have detected high molecular weight LYVE-1 transcripts in some tissues by Northern blotting (see Fig. 5), we have so far not observed alternatively spliced variants by RT-PCR. In the CD44 transmembrane anchor, a central cysteine residue (30) regulates HA binding in a cell-specific manner, through the formation of lipid domains within the bilayer (35, 39). No such residue is present in the LYVE-1 transmembrane anchor. Lastly, in the CD44 molecule, the 71-residue cytoplasmic tail binds the cytoskeletal components ankyrin and ezrin (52), and is subject to serine phosphorylation that regulates cell motility on HA substrata (16, 38). Although the lack of sequence conservation does not rule out the possibility that LYVE-1 interacts with these cytoskeletal components via different residues or that the LYVE-1 cytoplasmic tail interacts with other as yet undefined molecules, it seems unlikely that the mechanisms which regulate CD44-HA interactions are duplicated for LYVE-1, its closest known homologue.

Perhaps the most striking distinction between LYVE-1 and CD44 is in their patterns of tissue expression. Intriguingly, the LYVE-1 molecule is largely if not exclusively restricted to lymph vessel endothelial cells from which CD44 is almost completely absent. Comprehensive analyses of a large panel of human tissues by immunoperoxidase staining with specific antisera revealed LYVE-1 lining the lymphatics in virtually every tissue where these structures could be distinguished, and included vessels draining gastrointestinal tissues, skin, lymph nodes, breast, and salivary gland. The greatest concentration of LYVE-1 expression was seen in submucosal lymph vessels underlying smooth muscle in the colon, and the Lacteal vessels of intestinal villi that transport dietary lipid absorbed from the small intestine. Lymphatic vessels are morphologically distinguishable from blood vessels by their reduced or missing basement membrane and lack of erythrocyte content. There are currently no specific immunochemical markers that allow identification of lymphatics, although limited studies with endothelial markers indicate differential expression of the L-selectin ligand CD34 and the coagulation Factor VIII–related protein vWF (32, 42). Our own results using double immunofluorescence indicate that LYVE-1 defines a set of lymphatic vessels which express neither CD34 nor vWF and identify LYVE-1 as a powerful new marker for future studies of lymphatic structure and function.

The absence of LYVE-1 from vascular endothelial cells, in addition to its absence from lymphocytes, macrophages, fibroblasts, and epithelial cells, implies a rather different physiological role from that of the CD44 molecule, which is expressed abundantly in each of these locations (41) but is largely absent from lymphatic vessels. The primary role of the CD44 HA receptor appears to be the regulation of cell motility (50), as evidenced by its association with the migration of mesenchymal cells during differentiation, and with the hematogenous spread of tumor cells in experimental neoplasia (47). This is also apparent in inflammation, where CD44 expression on lymphocytes promotes migration through HA-coated vascular endothelium (7, 8), as well as the migration of lymphocytes through HA-coated reticular networks within peripheral lymph nodes (6). LYVE-1 by contrast appears to be restricted to relatively nonmotile lymphatic endothelial cells, where it seems more likely to function in the immobilization of HA in the vessel lumen, rather than in its recognition as a positional cue for migration.

A prominent function of the lymphatic system is the provision of fluid drainage of immune cells and foreign antigens from the tissues to the peripheral lymph nodes, where the latter are sampled by professional antigen-presenting cells and phagocytes. Lymph fluid contains high levels (40–50 μg/ml) of HA (see ref. 12 and reviewed in ref. 10), and its flux through the lymphatics is known to increase in inflammatory diseases such as rheumatoid arthritis and psoriasis and in response to bacterial infection (10, 27). The lymph vessels thus act as a conduit both for migrating inflammatory cells and for HA, although the precise relationship between the two is not clear. One possibility is that LYVE-1 functions as an endocytic receptor in an analogous fashion to CD44 on macrophages and the LEC HA receptors on liver endothelium. The specificity of LYVE-1 for HA does, however, appear to rule out any likelihood that it is the receptor involved in HA uptake and degradation within the lymph node. Alternatively, since inflammatory cells express CD44, we are tempted to speculate that LYVE-1 molecules may promote their adhesion to lymphatic endothelium via HA. Such a role is supported by our finding that LYVE-1 and HA colocalize to the luminal face of the lymph vessels, and that LYVE-1 can support HA-mediated adhesion to CD44. We are currently performing experiments to distinguish between these and other interesting possibilities.

We thank Professor David Y. Mason and Professor Kevin Gatter (Department of Cellular Science, University of Oxford) for helpful discussions and for the generous donation of multiple tissue sections and reagents for immunohistochemistry. We also gratefully acknowledge Mr. Simon Biddulph (Paediatric Pathology Laboratory, Oxford Radcliffe Hospital) for preparing paraffin-embedded sections for microscopy.

This study was supported by a Medical Research Council Senior Fellowship and a Cancer Research Campaign Project Grant to D. Jackson.