|
|
UniSTS:50247 |
Links |
WI-15995 |
Bos taurus chromosome 11, loci LOC782101 and COPS2 |
Canis familiaris chromosome 30, locus COPS2 |
Equus caballus chromosome 1, locus LOC100055653 |
Gallus gallus chromosome 10, locus COPS2 |
Homo sapiens chromosome 15, locus COPS2 |
Macaca mulatta chromosome 7, locus LOC714814 |
Monodelphis domestica chromosome 3;1 |
Mus musculus chromosome 2, locus Cops2 |
Pan troglodytes chromosome 15, locus COPS2 |
Rattus norvegicus chromosome 3, locus Cops2 |
Sus scrofa locus COPS2 |
Found by e-PCR in sequences from Bos taurus, Canis familiaris, Gallus gallus, Homo sapiens, Mus musculus, Ovis aries, Pan troglodytes, Rattus norvegicus and Sus scrofa. |
Primer Information | |
Forward primer: | GCTGCACTGTTTATTTTGCTG |
Reverse primer: | AATGTTTGCTGCATTTTGCA |
PCR product size: | 150 (bp), Homo sapiens |
GenBank Accession: | G24096
H01167
|
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 613584 |
| Symbol: | COPS2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Position: | |
Gene |
GeneID: | 782101 |
| Symbol: | LOC782101 |
| Description: | similar to TRIP15-ISO |
| Position: | |
UniGene | Bt.74827 |
Similar to COP9 complex subunit 2 |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 11 |
Map Viewer |
|
Position: |
86678749-86678898 (bp) |
|
Electronic PCR results |
|
RefSeq mRNA (1) |
XM_001250691.1 |
1832 .. 1981 (150 bp) |
|
Genomic (1) |
CM000187.3 |
86678749 .. 86678898 (150 bp) |
|
Working Draft phase 1 (from GenBank HTGS division) (2) |
AC182945.2 |
125861 .. 126010 (150 bp) |
AC219962.1 |
24794 .. 24943 (150 bp) |
|
ESTs (5 of 10)[Show All Hits] |
AM032760.1 |
573 .. 722 (150 bp) |
AM033417.1 |
13 .. 162 (150 bp) |
DV883486.1 |
309 .. 458 (150 bp) |
DV907062.1 |
118 .. 267 (150 bp) |
DV922968.1 |
118 .. 267 (150 bp) |
|
Whole Genome Shotgun sequences (1) |
AAFC03041781.1 |
24794 .. 24943 (150 bp) |
|
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 478295 |
| Symbol: | COPS2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Position: | |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 30 |
Map Viewer |
|
Position: |
18325806-18325956 (bp) |
|
Electronic PCR results |
|
RefSeq mRNA (5) |
XM_535470.2 |
1829 .. 1979 (151 bp) |
XM_856858.1 |
1703 .. 1853 (151 bp) |
XM_856888.1 |
1736 .. 1886 (151 bp) |
XM_856916.1 |
1832 .. 1982 (151 bp) |
XM_845582.1 |
1880 .. 2030 (151 bp) |
|
Genomic (1) |
CM000030.2 |
18325806 .. 18325956 (151 bp) |
|
ESTs (1) |
CF409150.1 |
436 .. 586 (151 bp) |
|
Whole Genome Shotgun sequences (1) |
AAEX02018873.1 |
73942 .. 74092 (151 bp) |
|
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 100055653 |
| Symbol: | LOC100055653 |
| Description: | similar to COP9 complex subunit 2 |
| Position: | |
UniGene | Eca.14068 |
Similar to COP9 complex subunit 2 |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 1 |
Map Viewer |
|
Position: |
140756201-140756350 (bp) |
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 430917 |
| Symbol: | COPS2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Position: | |
UniGene | Gga.4801 |
COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 10 |
Map Viewer |
|
Position: |
11987052-11987199 (bp) |
|
Electronic PCR results |
|
Genomic (1) |
CM000102.2 |
11987052 .. 11987199 (148 bp) |
|
Working Draft phase 1 (from GenBank HTGS division) (1) |
AC200276.1 |
109064 .. 109211 (148 bp) |
|
ESTs (5 of 7)[Show All Hits] |
AJ395166.1 |
150 .. 297 (148 bp) |
BU241786.1 |
497 .. 644 (148 bp) |
BU394458.1 |
376 .. 523 (148 bp) |
BU349566.1 |
412 .. 559 (148 bp) |
BU469388.1 |
487 .. 634 (148 bp) |
|
Whole Genome Shotgun sequences (1) |
AADN02045200.1 |
3537 .. 3684 (148 bp) |
|
Name: |
WI-15995 |
Also known as: |
EST261047 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 9318 |
| Symbol: | COPS2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Position: | 15q21.2 |
UniGene | Hs.369614 |
COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 15|HuRef |
Map Viewer |
|
Position: |
26251627-26251776 (bp) |
|
WI-15995 |
Sequence Map: |
Chr 15|Celera |
Map Viewer |
|
Position: |
26313128-26313277 (bp) |
|
WI-15995 |
Sequence Map: |
Chr 15 |
Map Viewer |
|
Position: |
47206846-47206995 (bp) |
|
WI-15995 |
NCBI RH Map: |
Chr 15 |
Map Viewer |
|
Position: |
196.9 (cR) |
|
Lod score: |
1.93 |
|
WI-15995 |
Whitehead-RH Map: |
Chr 15 |
Map Viewer |
|
Position: |
121.6 (cR3000) |
|
Lod score: |
P1.50 |
|
WI-15995 |
GeneMap99-GB4 Map: |
Chr 15 |
Map Viewer |
|
Position: |
168.93 (cR3000) |
|
Lod score: |
0.87 |
|
Reference Interval: |
D15S146-D15S117 |
|
Electronic PCR results |
|
mRNA (5 of 6)[Show All Hits] |
AF120268.1 |
1769 .. 1918 (150 bp) |
AF100762.1 |
1778 .. 1927 (150 bp) |
AF212227.1 |
1799 .. 1948 (150 bp) |
BX648602.1 |
157 .. 306 (150 bp) |
AB209799.1 |
1802 .. 1951 (150 bp) |
|
Genomic (5 of 8)[Show All Hits] |
G24096.1 |
1 .. 150 (150 bp) |
AC013452.9 |
89961 .. 90110 (150 bp) |
CH003462.1 |
25762659 .. 25762808 (150 bp) |
CH003510.1 |
28168431 .. 28168580 (150 bp) |
CH471082.1 |
5410945 .. 5411094 (150 bp) |
|
ESTs (5 of 83)[Show All Hits] |
Z28951.1 |
12 .. 161 (150 bp) |
H01167.1 |
1 .. 150 (150 bp) |
H40491.1 |
8 .. 157 (150 bp) |
N50808.1 |
20 .. 169 (150 bp) |
N62168.1 |
19 .. 168 (150 bp) |
|
Whole Genome Shotgun sequences (4) |
AADD01143121.1 |
3006 .. 3155 (150 bp) |
AADC01120706.1 |
7323 .. 7472 (150 bp) |
AADB02016439.1 |
34553 .. 34702 (150 bp) |
ABBA01039130.1 |
66550 .. 66699 (150 bp) |
|
|
Cross References |
|
UniGene | Mfa.8834 |
Macaca fascicularis brain cDNA clone: QmoA-10308, similar to human aminoacyl... |
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 714814 |
| Symbol: | LOC714814 |
| Description: | similar to COP9 (constitutive photomorphogenic) homolog, subunit 2 |
| Position: | |
UniGene | Mmu.2891 |
Similar to COP9 (constitutive photomorphogenic) homolog, subunit 2 |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 7 |
Map Viewer |
|
Position: |
27449069-27449218 (bp) |
Name: |
WI-15995 |
Polymorphism info: |
|
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 1 |
Map Viewer |
|
Position: |
179526037-179526186 (bp) |
|
WI-15995 |
Sequence Map: |
Chr 3 |
Map Viewer |
|
Position: |
268567789-268567938 (bp) |
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 12848 |
| Symbol: | Cops2 |
| Description: | COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) |
| Position: | 2 F1|2 70.0 cM |
UniGene | Mm.3596 |
COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thalian... |
| Mm.442150 |
Transcribed locus |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 2 |
Map Viewer |
|
Position: |
125657347-125657491 (bp) |
|
WI-15995 |
Sequence Map: |
Chr 2|Celera |
Map Viewer |
|
Position: |
127075825-127075969 (bp) |
|
Electronic PCR results |
|
RefSeq mRNA (1) |
NM_009939.2 |
1799 .. 1943 (145 bp) |
|
mRNA (2) |
AF071312.1 |
1773 .. 1917 (145 bp) |
BC023096.1 |
1768 .. 1912 (145 bp) |
|
Genomic (3) |
AL844580.13 |
123133 .. 123277 (145 bp) |
CH466519.1 |
86971119 .. 86971263 (145 bp) |
CM000210.1 |
124075825 .. 124075969 (145 bp) |
|
ESTs (5 of 85)[Show All Hits] |
AA277939.1 |
206 .. 350 (145 bp) |
C85265.1 |
10 .. 154 (145 bp) |
C85478.1 |
10 .. 154 (145 bp) |
AA960372.1 |
5 .. 149 (145 bp) |
AI037489.1 |
330 .. 474 (145 bp) |
|
Whole Genome Shotgun sequences (2) |
CAAA01206279.1 |
4741 .. 4885 (145 bp) |
AAHY01020415.1 |
11600 .. 11744 (145 bp) |
|
Name: |
WI-15995 |
Polymorphism info: |
|
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr Un|NW_001722034.1 |
Map Viewer |
|
Position: |
10805-10970 (bp) |
|
Cross References |
|
UniGene | Ocu.1576 |
Transcribed locus |
| Ocu.6664 |
Transcribed locus, strongly similar to NP_001026767.1 COP9 constitutive phot... |
|
Cross References |
|
UniGene | Oar.13942 |
Transcribed locus |
| Oar.6213 |
Transcribed locus, strongly similar to NP_001026767.1 COP9 constitutive phot... |
|
Electronic PCR results |
|
ESTs (3) |
EE752006.1 |
271 .. 420 (150 bp) |
EE857089.1 |
426 .. 575 (150 bp) |
FE032738.1 |
31 .. 180 (150 bp) |
|
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 453417 |
| Symbol: | COPS2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Position: | |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 15 |
Map Viewer |
|
Position: |
46376317-46376466 (bp) |
|
Electronic PCR results |
|
RefSeq mRNA (2) |
XM_510388.2 |
1850 .. 1999 (150 bp) |
XM_001166766.1 |
1880 .. 2029 (150 bp) |
|
Genomic (1) |
CM000329.1 |
46376317 .. 46376466 (150 bp) |
|
Whole Genome Shotgun sequences (2) |
AADA01019783.1 |
5523 .. 5672 (150 bp) |
AACZ02154837.1 |
7222 .. 7371 (150 bp) |
|
Name: |
WI-15995 |
Polymorphism info: |
|
|
Cross References |
|
Gene |
GeneID: | 261736 |
| Symbol: | Cops2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |
| Position: | 3q36 |
UniGene | Rn.11556 |
COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thalian... |
|
Mapping Information | |
WI-15995 |
Sequence Map: |
Chr 3|Celera |
Map Viewer |
|
Position: |
111940311-111940455 (bp) |
|
WI-15995 |
Sequence Map: |
Chr 3 |
Map Viewer |
|
Position: |
113142053-113142197 (bp) |
|
Electronic PCR results |
|
RefSeq mRNA (1) |
NM_153297.1 |
1906 .. 2049 (144 bp) |
|
mRNA (2) |
AB081072.1 |
1906 .. 2049 (144 bp) |
BC061864.1 |
1696 .. 1840 (145 bp) |
|
Genomic (3) |
CM000074.1 |
113142053 .. 113142197 (145 bp) |
CH473949.1 |
68704187 .. 68704331 (145 bp) |
CM000233.2 |
111940311 .. 111940455 (145 bp) |
|
Working Draft phase 2 (from GenBank HTGS division) (1) |
AC105523.5 |
190262 .. 190406 (145 bp) |
|
ESTs (5 of 19)[Show All Hits] |
AA148332.1 |
12 .. 156 (145 bp) |
AI385264.1 |
22 .. 166 (145 bp) |
AW520778.1 |
29 .. 173 (145 bp) |
AW521892.1 |
30 .. 174 (145 bp) |
BG379986.1 |
21 .. 165 (145 bp) |
|
Whole Genome Shotgun sequences (2) |
AABR03025017.1 |
41055 .. 41199 (145 bp) |
AAHX01024871.1 |
2880 .. 3024 (145 bp) |
|
|
Cross References |
|
Gene |
GeneID: | 100125956 |
| Symbol: | COPS2 |
| Description: | COP9 constitutive photomorphogenic homolog subunit 2 |
| Position: | |
UniGene | Ssc.13757 |
COP9 constitutive photomorphogenic homolog subunit 2 |
|
Electronic PCR results |
|
ESTs (5 of 17)[Show All Hits] |
CO987575.1 |
12 .. 161 (150 bp) |
DN124753.1 |
514 .. 663 (150 bp) |
DN125115.1 |
17 .. 166 (150 bp) |
DB806309.1 |
42 .. 191 (150 bp) |
EV869345.1 |
325 .. 472 (148 bp) |
|
|
Cross References |
|
UniGene | Tgu.2684 |
Transcribed locus, strongly similar to NP_001026767.1 COP9 constitutive phot... |
|
Cross References |
|
UniGene | Str.24008 |
MGC97656 protein |
|