PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:182413 Links SHGC-148820 Homo sapiens chromosome 11, locus HCCA2 Pan troglodytes chromosome 11, locus LOC741421 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AAAGTGGACTCTGCTGCAAAATG Reverse primer: AACAGGGCAGACAGATGTGCTA PCR product size: 109 (bp), Homo sapiens    Homo sapiens Name: SHGC-148820 Polymorphism info:   Cross References Gene GeneID: 81532   Symbol: HCCA2   Description: HCCA2 protein   Position: 11p15.5 UniGene Hs.370360 HCCA2 protein Mapping Information SHGC-148820 Sequence Map: Chr 11|HuRef Map Viewer   Position: 1295574-1295682 (bp)   SHGC-148820 Sequence Map: Chr 11 Map Viewer   Position: 1464196-1464304 (bp)   SHGC-148820 Sequence Map: Chr 11|Celera Map Viewer   Position: 1539408-1539516 (bp)   SHGC-148820 TNG Map: Chr 11 Map Viewer   Position: 945 (cR50000)   Lod score: 6.2   Reference Interval: 4 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC091196.6 95128 .. 95236 (109 bp)   CH003458.1 1432399 .. 1432507 (109 bp)   CH003506.1 402561 .. 402669 (109 bp)   CH471158.1 1119164 .. 1119272 (109 bp)   CM000262.1 1539408 .. 1539516 (109 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC074189.3 161200 .. 161308 (109 bp)     ESTs (1) DB288846.1 263 .. 371 (109 bp)     Whole Genome Shotgun sequences (4) AADD01112395.1 22345 .. 22453 (109 bp)   AADC01095563.1 3387 .. 3495 (109 bp)   AADB02013499.1 44573 .. 44681 (109 bp)   ABBA01012144.1 49905 .. 50013 (109 bp)        Pan troglodytes Name: SHGC-148820 Polymorphism info:   Cross References Gene GeneID: 741421   Symbol: LOC741421   Description: similar to HCCA2 protein   Position:   Mapping Information SHGC-148820 Sequence Map: Chr 11 Map Viewer   Position: 1523749-1523857 (bp) Electronic PCR results Genomic (1) CM000325.1 1523749 .. 1523857 (109 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC192723.1 214864 .. 214972 (109 bp)     Whole Genome Shotgun sequences (2) AADA01303104.1 2886 .. 2994 (109 bp)   AACZ02121789.1 34159 .. 34267 (109 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement