|
ACTTCGTCAGTAACGGACGGACCGCTGGGAATGCAGCT |
Position |
Feature |
1 |
.. |
18 |
universal PCR primer |
19 |
.. |
38 |
allele specific primer 1 |
38 |
.. |
38 |
variation rs6062317 |
GAGTCGAGGTCATATCGTGGACCGCTGGGAATGCAGCC |
Position |
Feature |
1 |
.. |
18 |
universal PCR primer |
19 |
.. |
38 |
allele specific primer 2 |
38 |
.. |
38 |
variation rs6062317 |
ATGCATCTCAAAGGGCAGCCTCTATATCGGGGAATGTAGC
ACGTCTGCCTATAGTGAGTC |
Position |
Feature |
1 |
.. |
18 |
locus specific primer |
19 |
.. |
42 |
address sequence |
43 |
.. |
60 |
universal PCR primer |
|
|
Gunderson KL, et al. A genome-wide scalable SNP genotyping assay using microarray technology. Nat Genet. 2005 May;37(5):549-554.
|
|
HapMap
The International HapMap Project is a partnership of scientists and funding agencies from Canada, China, Japan, Nigeria, the United Kingdom and the United States to develop a public resource that will help researchers find genes associated with human disease and response to pharmaceuticals.
|
|
Created On: 09-Aug-2005
Sequence Updated On: 16-Sep-2005
Annotation Updated On: 16-Sep-2005
From HapMap project. |
|
|
|