PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:79968 Links RH48342 Homo sapiens chromosome 3, locus LRRN1 Macaca mulatta chromosome 2, locus LRCH4 Pan troglodytes chromosome 3, loci SUMF1 and LOC460132 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTGCTATGTATTGAGCACTGGG Reverse primer: GTTTCCTGGTGTTTGTCTTGC PCR product size: 146 (bp), Homo sapiens    Homo sapiens Name: RH48342 Also known as: stSG30093 Polymorphism info:   Cross References Gene GeneID: 57633   Symbol: LRRN1   Description: leucine rich repeat neuronal 1   Position: 3p26.2 UniGene Hs.163244 Leucine rich repeat neuronal 1 Mapping Information RH48342 Sequence Map: Chr 3|HuRef Map Viewer   Position: 3819360-3819505 (bp)   RH48342 Sequence Map: Chr 3|Celera Map Viewer   Position: 3824380-3824525 (bp)   RH48342 Sequence Map: Chr 3 Map Viewer   Position: 3859299-3859444 (bp)   stSG30093 NCBI RH Map: Chr 3 Map Viewer   Position: 10 (cR)   Lod score: 1.98   stSG30093 GeneMap99-GB4 Map: Chr 3 Map Viewer   Position: 20.47 (cR3000)   Lod score: 0.00   Reference Interval: D3S1620-D3S1304 Electronic PCR results mRNA (2) AB040930.1 1241 .. 1386 (146 bp)   AK022707.1 1697 .. 1842 (146 bp)     Genomic (5 of 9)[Show All Hits] AC016146.18 40943 .. 41088 (146 bp)   AC024167.6 104661 .. 104806 (146 bp)   AC023484.5 172428 .. 172573 (146 bp)   CH003450.1 3824076 .. 3824221 (146 bp)   CH003498.1 1626423 .. 1626568 (146 bp)     ESTs (2) AA151700.1 36 .. 181 (146 bp)   AU149277.2 202 .. 347 (146 bp)     Whole Genome Shotgun sequences (4) AADD01029838.1 931 .. 1076 (146 bp)   AADC01025539.1 228454 .. 228599 (146 bp)   AADB02003079.1 3025001 .. 3025146 (146 bp)   ABBA01020479.1 35893 .. 36038 (146 bp)        Macaca mulatta Name: RH48342 Polymorphism info:   Cross References Gene GeneID: 703993   Symbol: LRCH4   Description: leucine-rich repeats and calponin homology (CH) domain containing 4   Position:   Mapping Information RH48342 Sequence Map: Chr 2 Map Viewer   Position: 57166438-57166582 (bp)    Pan troglodytes Name: RH48342 Polymorphism info:   Cross References Gene GeneID: 460132   Symbol: LOC460132   Description: hypothetical LOC460132   Position:   Gene GeneID: 470739   Symbol: SUMF1   Description: sulfatase modifying factor 1   Position:   Mapping Information RH48342 Sequence Map: Chr 3 Map Viewer   Position: 3960587-3960732 (bp) Electronic PCR results Genomic (1) CM000317.1 3960587 .. 3960732 (146 bp)     Whole Genome Shotgun sequences (1) AACZ02033346.1 1510 .. 1655 (146 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement