PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:73212 Links WI-22215 Homo sapiens chromosome 6, locus C6orf125 Pan troglodytes chromosome 6, locus IP6K3 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TGGCAAAGCCATAAACACTG Reverse primer: CCAGTCCAGATGGGAAGAAA PCR product size: 277 (bp), Homo sapiens GenBank Accession: Z39469    Homo sapiens Name: WI-22215 Also known as: HSA.29775 STS-Z39469 Polymorphism info:   Cross References Gene GeneID: 84300   Symbol: C6orf125   Description: chromosome 6 open reading frame 125   Position: 6p21.31 UniGene Hs.657444 Transcribed locus Mapping Information WI-22215 Sequence Map: Chr 6|HuRef Map Viewer   Position: 33417285-33417561 (bp)   WI-22215 Sequence Map: Chr 6 Map Viewer   Position: 33783608-33783884 (bp)   WI-22215 Sequence Map: Chr 6|Celera Map Viewer   Position: 35230019-35230295 (bp)   WI-22215 NCBI RH Map: Chr 6 Map Viewer   Position: 509.1 (cR)   Lod score: 1.14   WI-22215 Whitehead-RH Map: Chr 6 Map Viewer   Position: 177.5 (cR3000)   Lod score: P2.49   WI-22215 GeneMap99-GB4 Map: Chr 6 Map Viewer   Position: 121.01 (cR3000)   Lod score: 3.00   Reference Interval: D6S1558-D6S1616 Electronic PCR results Genomic (5 of 7)[Show All Hits] AL139044.15 93280 .. 93556 (277 bp)   CH003453.1 33715993 .. 33716269 (277 bp)   CH003501.1 35435679 .. 35435955 (277 bp)   CH471081.1 6694340 .. 6694616 (277 bp)   CM000257.1 35230019 .. 35230295 (277 bp)     ESTs (1) Z39469.1 74 .. 350 (277 bp)     Whole Genome Shotgun sequences (4) AADD01068617.1 46375 .. 46651 (277 bp)   AADC01059255.1 53758 .. 54034 (277 bp)   AADB02010022.1 610786 .. 611062 (277 bp)   ABBA01038161.1 61400 .. 61676 (277 bp)        Pan troglodytes Name: WI-22215 Polymorphism info:   Cross References Gene GeneID: 471985   Symbol: IP6K3   Description: inositol hexakisphosphate kinase 3   Position:   Mapping Information WI-22215 Sequence Map: Chr 6 Map Viewer   Position: 34425901-34426177 (bp) Electronic PCR results Genomic (1) CM000320.1 34425901 .. 34426177 (277 bp)     Whole Genome Shotgun sequences (2) AADA01296097.1 3950 .. 4226 (277 bp)   AACZ02070525.1 18448 .. 18724 (277 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement