PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:71533 Links SGC31622 Homo sapiens chromosome 22;11, loci SLC25A1 and LOC100131457 Macaca mulatta chromosome 10;1, loci SLC25A1 and LOC695722 Pan troglodytes chromosome 22;11, loci LOC749107 and SLC25A1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TGCAGTAGTGCCAAAAGGC Reverse primer: GGTCACGTGACACAGAACATG PCR product size: 202 (bp), Homo sapiens GenBank Accession: G26811 U25147    Homo sapiens Name: SGC31622 Also known as: STS_U25147 Polymorphism info:   Cross References Gene GeneID: 100131457   Symbol: LOC100131457   Description: similar to Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1   Position: 11q14.2 Gene GeneID: 6576   Symbol: SLC25A1   Description: solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1   Position: 22q11.21 UniGene Hs.111024 Solute carrier family 25 (mitochondrial carrier; citrate transporter), membe...   Hs.611480 Transcribed locus Mapping Information SGC31622 Sequence Map: Chr 11|HuRef Map Viewer   Position: 81943953-81944201 (bp)   SGC31622 Sequence Map: Chr 11|Celera Map Viewer   Position: 82956057-82956305 (bp)   SGC31622 Sequence Map: Chr 11 Map Viewer   Position: 85324424-85324672 (bp)   SGC31622 Sequence Map: Chr 22 Map Viewer   Position: 17543368-17543569 (bp)   SGC31622 Sequence Map: Chr 22|HuRef Map Viewer   Position: 2784445-2784646 (bp)   SGC31622 Sequence Map: Chr 22|Celera Map Viewer   Position: 3015313-3015548 (bp)   SGC31622 Whitehead-RH Map: Chr 22 Map Viewer   Position: 1.8 (cR3000)   Lod score: P>3.00   SGC31622 GeneMap99-GB4 Map: Chr 22 Map Viewer   Position: 2.63 (cR3000)   Lod score: 0.07   Reference Interval: pTEL-D22S420 Electronic PCR results RefSeq mRNA (1) NM_005984.1 1111 .. 1346 (236 bp)     mRNA (5 of 6)[Show All Hits] U25147.1 1084 .. 1285 (202 bp)   L77567.1 1082 .. 1283 (202 bp)   BC004980.1 1063 .. 1298 (236 bp)   L75823.1 1111 .. 1346 (236 bp)   BC008061.2 1065 .. 1300 (236 bp)     Genomic (5 of 17)[Show All Hits] G26811.1 77 .. 278 (202 bp)   L77569.1 418 .. 619 (202 bp)   AC004463.2 32869 .. 33070 (202 bp)   AP000767.4 3667 .. 3915 (249 bp)   L76134.1 2883 .. 3084 (202 bp)     Working Draft phase 1 (from GenBank HTGS division) (5) AC016486.4 140655 .. 140903 (249 bp)   AP000645.2 13392 .. 13640 (249 bp)   AL359537.4 15785 .. 16020 (236 bp)   AC055755.9 140238 .. 140486 (249 bp)   AL391096.11 85589 .. 85824 (236 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC015695.3 79129 .. 79377 (249 bp)     ESTs (5 of 135)[Show All Hits] T50580.1 81 .. 283 (203 bp)   AA251179.1 150 .. 351 (202 bp)   AA291975.1 94 .. 294 (201 bp)   AA410707.1 95 .. 296 (202 bp)   AA932897.1 270 .. 471 (202 bp)     Whole Genome Shotgun sequences (5 of 8)[Show All Hits] AADD01173327.1 14726 .. 14961 (236 bp)   AADD01117852.1 13069 .. 13317 (249 bp)   AADC01143075.1 173876 .. 174111 (236 bp)   AADC01100526.1 6812 .. 7060 (249 bp)   AADB02020420.1 485639 .. 485874 (236 bp)        Macaca mulatta Name: SGC31622 Polymorphism info:   Cross References Gene GeneID: 695722   Symbol: LOC695722   Description: similar to sex comb on midleg homolog 1   Position:   Gene GeneID: 719075   Symbol: SLC25A1   Description: solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1   Position:   UniGene Mmu.10146 Solute carrier family 25 (mitochondrial carrier; citrate transporter), membe... Mapping Information SGC31622 Sequence Map: Chr 1 Map Viewer   Position: 43978665-43978915 (bp)   SGC31622 Sequence Map: Chr 10 Map Viewer   Position: 63218842-63219070 (bp)    Pan troglodytes Name: SGC31622 Polymorphism info:   Cross References Gene GeneID: 458647   Symbol: SLC25A1   Description: solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1   Position:   Gene GeneID: 749107   Symbol: LOC749107   Description: similar to mitochondrial citrate transport protein   Position:   Mapping Information SGC31622 Sequence Map: Chr 11 Map Viewer   Position: 84547979-84548227 (bp)   SGC31622 Sequence Map: Chr 22 Map Viewer   Position: 17613790-17614025 (bp) Electronic PCR results RefSeq mRNA (3) XM_001165281.1 1173 .. 1408 (236 bp)   XM_514976.2 1158 .. 1393 (236 bp)   XM_001165211.1 1243 .. 1478 (236 bp)     Genomic (2) CM000335.1 17613790 .. 17614025 (236 bp)   CM000325.1 84547979 .. 84548227 (249 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC214967.1 87972 .. 88207 (236 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC129838.77 20830 .. 21065 (236 bp)     Whole Genome Shotgun sequences (4) AADA01255162.1 20856 .. 21091 (236 bp)   AADA01219588.1 8532 .. 8780 (249 bp)   AACZ02193952.1 17595 .. 17830 (236 bp)   AACZ02126917.1 23570 .. 23818 (249 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement