PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:6795 Links SHGC-31753 Homo sapiens chromosome 13, locus UBAC2 Macaca mulatta chromosome 17, locus LOC703484 Pan troglodytes chromosome 13, locus UBAC2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AATTTGCATCAATTTGATACATCG Reverse primer: GACCGCCATGAGCATGAA PCR product size: 102 (bp), Homo sapiens GenBank Accession: G24770 G27101 T15584    Homo sapiens Name: SHGC-31753 Also known as: EST41304 SGC31753 Polymorphism info:   Cross References Gene GeneID: 337867   Symbol: UBAC2   Description: UBA domain containing 2   Position: 13q32.3 UniGene Hs.508545 UBA domain containing 2 Mapping Information SHGC-31753 Sequence Map: Chr 13|HuRef Map Viewer   Position: 80632859-80632960 (bp)   SHGC-31753 Sequence Map: Chr 13|Celera Map Viewer   Position: 80882142-80882243 (bp)   SHGC-31753 Sequence Map: Chr 13 Map Viewer   Position: 98836542-98836643 (bp)   SHGC-31753 NCBI RH Map: Chr 13 Map Viewer   Position: 923.7 (cR)   Lod score: 2.09   SHGC-31753 Stanford-G3 Map: Chr 13 Map Viewer   Position: 2865 (cR10000)   Lod score: F   Reference Interval: 30   SGC31753 Whitehead-RH Map: Chr 13 Map Viewer   Position: 273.9 (cR3000)   Lod score: P1.25   SHGC-31753 GeneMap99-G3 Map: Chr 13 Map Viewer   Position: 3164 (cR10000)   Lod score: F   Reference Interval: D13S159-D13S280   SGC31753 GeneMap99-GB4 Map: Chr 13 Map Viewer   Position: 282.92 (cR3000)   Lod score: 0.01   Reference Interval: D13S159-D13S280 Electronic PCR results RefSeq mRNA (1) NM_177967.2 2386 .. 2487 (102 bp)     mRNA (5 of 10)[Show All Hits] AF339812.1 1455 .. 1556 (102 bp)   AK054563.1 2386 .. 2487 (102 bp)   AK055110.1 2168 .. 2269 (102 bp)   AK075419.1 2042 .. 2143 (102 bp)   AK075516.1 1812 .. 1913 (102 bp)     Genomic (5 of 9)[Show All Hits] G24770.1 40 .. 141 (102 bp)   G27101.1 40 .. 141 (102 bp)   AL136961.19 34251 .. 34352 (102 bp)   CH003460.1 80716360 .. 80716461 (102 bp)   CH003508.1 85578694 .. 85578795 (102 bp)     ESTs (5 of 171)[Show All Hits] T03476.1 40 .. 141 (102 bp)   T15584.1 40 .. 141 (102 bp)   R37683.1 53 .. 154 (102 bp)   R39175.1 51 .. 152 (102 bp)   R50696.1 41 .. 142 (102 bp)     Whole Genome Shotgun sequences (4) AADD01134831.1 754 .. 855 (102 bp)   AADC01115536.1 67650 .. 67751 (102 bp)   AADB02016011.1 908455 .. 908556 (102 bp)   ABBA01027122.1 5629 .. 5730 (102 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.9009 Macaca fascicularis testis cDNA clone: QtsA-10993, similar to human phosphog...    Macaca mulatta Name: SHGC-31753 Polymorphism info:   Cross References Gene GeneID: 703484   Symbol: LOC703484   Description: similar to phosphoglycerate dehydrogenase like 1   Position:   Mapping Information SHGC-31753 Sequence Map: Chr 17 Map Viewer   Position: 79760328-79760429 (bp)    Pan troglodytes Name: SHGC-31753 Polymorphism info:   Cross References Gene GeneID: 740191   Symbol: UBAC2   Description: UBA domain containing 2   Position:   Mapping Information SHGC-31753 Sequence Map: Chr 13 Map Viewer   Position: 100192068-100192169 (bp) Electronic PCR results RefSeq mRNA (1) XM_001142071.1 2701 .. 2802 (102 bp)     Genomic (1) CM000327.1 100192068 .. 100192169 (102 bp)     Whole Genome Shotgun sequences (2) AADA01250197.1 18181 .. 18282 (102 bp)   AACZ02144805.1 8429 .. 8530 (102 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement