|
|
Dispatch
Mycobacterium avium subsp.
paratuberculosis Infection in a Patient with HIV, Germany
Elvira Richter,* Johannes Wessling,† Norbert Lügering,† Wolfram Domschke,†
and Sabine Rüsch-Gerdes*
*National Reference Center for Mycobacteria, Borstel, Germany; and
†University of Münster, Münster, Germany
Mycobacterium
avium subsp.
paratuberculosis (MAP), the causative agent of Johne disease in
ruminants, has been incriminated as the cause of Crohn disease in humans.
We report the first case of human infection with MAP in a patient
with HIV; infection was confirmed by obtaining isolates from several
different specimen types.
Opportunistic infections caused by various Mycobacterium species
are among the leading AIDS indicator diseases in HIV-positive patients
(1). Infections with nontuberculous mycobacteria occur
mainly in patients who have low CD4+ counts (<50 cells) or high virus
counts (2); Mycobacterium avium complex
is the most important mycobacterial species. M. avium complex includes
the species M. avium and M. intracellulare, with M. avium
consisting of M. avium subsp. avium, M. avium subsp.
sylvaticum, and M. avium subsp. paratuberculosis
(MAP). All these subspecies have identical 16S rRNA gene and 16S to 23S
transcribed spacer sequences, as well as shared biochemical characteristics
(3). However, MAP is dependent on mycobactin for
its growth, whereas M. avium grows well on different solid media.
MAP is the causative agent of Johne disease, a chronic granulomatous
ileitis occurring mainly in ruminants (4). MAP has been
incriminated as the cause of Crohn disease in humans (5,6),
although conflicting findings have been reported. However, culture-confirmed
cases of MAP in human specimens remain rare (5,6).
Case Report
A 36-year-old HIV-positive man, who had been treated at our hospital
since 1995 for HIV, hepatitis C, and hemophilia, had profuse diarrhea
(6–8 episodes/day), fever as high as 39.9°C, and 10 kg of body weight
loss in 5 weeks. Laboratory findings included hemoglobin 9.6 g/dL, pseudocholinesterase
2,099 U/L, HIV-DNA virus count 500 copies/mL, CD4+ lymphocyte count 29
x 106/mL, and C-reactive protein 76 mg/L. Stained colon tissue
samples, bone marrow punch, and liver biopsy showed abundant acid-fast
bacilli. Endoscopic findings on colonoscopy were multiple polypoid lesions
approximately 5 mm in size in the transverse and sigmoid colon.
Microbiologic analyses included culture for mycobacteria (liquid media:
BACTEC 460TB or MGIT [Becton, Dickinson and Company, Cockeysville, MD]
and solid media produced in-house, all media without supplementation of
mycobactin) from at least 21 specimens (blood, urine, sputum, biopsy,
feces) over a 3-year period. Of these, eight specimens (blood, feces,
and biopsy) were positive for mycobacteria in liquid media after 6 to
16 weeks of incubation. Subcultures remained negative on Löwenstein-Jensen
slants but after approximately 4 weeks became positive on mycobactin-supplemented
Middlebrook slants with colorless dysgonic colonies. Microscopic examination
of these colonies showed acid-fast bacilli (Figure
1).
For species identification, AccuProbe assays (Gen-Probe, San Diego, CA)
for M. avium complex were performed on liquid media, all yielding
strong positive results. However, repeated attempts to perform drug-susceptibility
testing in the liquid BACTEC 460TB system were unsuccessful because of
insufficient growth of the control. Since M. avium complex usually
grows very well, the primary identification was questionable. Thus, polymerase
chain reaction (PCR) for the amplification of a part of the mycobacterial
gene coding for the ribosomal 16S RNA and additional sequencing was performed
from two positive cultures (7). The resulting sequence
was compared with those stored in the International Nucleotide Sequence
Database (8), showing the signature sequence of M.
avium/M. paratuberculosis, which is identical for both species
and confirmed the AccuProbe results. For further differentiation between
M. avium and MAP, PCR targeting the insertion sequence IS900
(primer: IS900-1: 5´ TGTTCGGGGCCGTCGCTTAG; IS900-2: 5´-CGTTCCAGCGCCGAAAGTAT),
which is present only in MAP strains (9), was
done with the two most recent positive cultures. This assay showed clearly
positive results from the two cultures tested and the MAP type
strain, while the M. avium strains remained negative (Figure
2).
Because acid-fast bacilli were identified in biopsy specimens, treatment
was started with ethambutol, ciprofloxacin, clarithromycin, and rifabutin.
Initially, no clinical improvement was observed, and the patient’s weight
loss and daily fever of 39C°–40°C continued. When ciprofloxacin was replaced
with levofloxacin, progression of the infection appeared to stop. However,
the patient died from cardiorespiratory failure.
Conclusions
We describe the case of an HIV-infected patient who had a severe mycobacterial
disorder thought to be caused by M. avium complex. Because growth
was insufficient for susceptibility testing, the presence of MAP was
assumed; however, the assumption was made after 2 years, because of difficulties
in isolating MAP from human specimens (e.g., blood) in media not thought
to enable its growth. Finally, the demonstration of the insertion sequence
IS900, an assay not routinely performed in human diagnostic laboratories
like ours, confirmed this hypothesis.
MAP isolated from human specimens has not yet been demonstrated
by routine techniques. Several studies have reported the presence of MAP
DNA in association with Crohn disease, although culture confirmation
remains rare in these patients (5,6).
In the case we describe, mycobacterial growth could be detected in liquid
media in 8 of 21 specimens, all confirmed as M. avium complex/M.
paratuberculosis. However, because of the limited growth, we assume
the presence of MAP even in those specimens not tested by IS900
PCR. These results indicate that MAP can grow to a limited extent
in routine liquid media without mycobactin supplementation, at least if
present in high amounts in the specimen.
Susceptibility testing of the isolated strains could not be performed
because of insufficient growth. Reports on susceptibility testing of
MAP are rare, yet data obtained by a luciferase-based susceptibility
assay (10) indicate susceptibility at least to clarithromycin
and rifabutin, which were included in therapy. However, the patient’s
response to treatment was not clearly positive and may have been hampered
by his general poor health. This report suggests a pathogenic role of
MAP for immunocompromised patients, raising the question of whether
this strain so far has not been detected because of its limited growth,
whether it has been misidentified as M. avium, or whether its occurrence
in infections is low. However, herd prevalence of bovine paratuberculosis
has been reported to range from 7% to 55% in Europe and to reach approximately
40% in stocks of >300 animals in the United States (4).
Thus, consumption of inadequately pasteurized dairy products may be a
possible risk for infection, especially for immunocompromised patients.
Acknowledgments
We thank Marie Thorel for providing the MAP type strain used as
positive control for IS900 PCR and Frauke Schaefer for excellent
technical assistance.
Dr. Richter is deputy of the German National Reference Center for Mycobacteria,
Borstel. She is a specialist in molecular microbiology.
References
- European Centre for the Epidemiological Monitoring
of AIDS. HIV/AIDS surveillance in Europe. Updated June 30, 2001. Available
from URL: http://www.eurohiv.org/sida.htm
- Brambilla AM, Castagna A, Nocita B, Hasson H, Boeri E, Veglia F, et
al. Relation
between CD4 cell counts and HIV RNA levels at onset of opportunistic
infections. J Acquir Immune Defic Syndr 2001;27:44–8.
- Thorel MF, Krichevsky M, Levy-Frebault VV. Numerical
taxonomy of mycobactin-dependent mycobacteria, emended description of
Mycobacterium avium, and description of Mycobacterium
avium subsp. avium subsp. nov., Mycobacterium avium
subsp. paratuberculosis subsp. nov., and Mycobacterium
avium subsp. silvaticum subsp. nov. Int J Syst
Bacteriol 1990;40:254–60.
- Manning EJ, Collins MT. Mycobacterium
avium
subsp. paratuberculosis: pathogen, pathogenesis and diagnosis.
Rev Sci Tech 2001;20:133–50.
- Collins MT, Lisby G, Moser C, Chicks D, Christensen S, Reichelderfer
M, et al. Results
of multiple diagnostic tests for Mycobacterium avium subsp. paratuberculosis
in patients with inflammatory bowel disease and in controls. J Clin
Microbiol 2000;38:4373–81.
- Schwartz D, Shafran I, Romero C, Piromalli C, Biggerstaff J, Naser
N, et al. Use
of short-term culture for identification of Mycobacterium avium
subsp. paratuberculosis in tissue from Crohn's disease patients.
Clin Microbiol Infect 2000;6:303–7.
- Richter E, Greinert U, Kirsten D, Rüsch-Gerdes S, Schlüter C, Duchrow
M, et al. Assessment
of mycobacterial DNA in cells and tissues of mycobacterial and sarcoid
lesions. Am J Respir Crit Care Med 1996;153:375–80.
- National Institutes of Health. International nucleotide sequence database
collaboration. Available from URL: http://www.ncbi.nlm.nih.gov
- Bauernfeind R, Benazzi S, Weiss R, Schliesser T, Willems H, Baljer
G. Molecular
characterization of Mycobacterium paratuberculosis isolates from
sheep, goats, and cattle by hybridization with a DNA probe to insertion
element IS900. J Clin Microbiol 1996;34:1617–21.
- Williams SL, Harris NB, Barletta RG. Development
of a firefly luciferase-based assay for determining antimicrobial susceptibility
of Mycobacterium avium subsp. paratuberculosis.
J Clin Microbiol 1999;37:304–9.
|
