PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:5540 Links SHGC-32243 Homo sapiens chromosome 13, locus KIAA0774 Pan troglodytes chromosome 13 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AATAGGCTTTAAACACAAATATGCA Reverse primer: GGCTGGATGTCAGAATGGAT PCR product size: 125 (bp), Homo sapiens GenBank Accession: G25758 G27458 T26932    Homo sapiens Name: SHGC-32243 Also known as: EST69363 SGC32243 Polymorphism info:   Cross References Gene GeneID: 23281   Symbol: KIAA0774   Description: KIAA0774   Position: 13q12.3 UniGene Hs.22287 KIAA0774   Hs.624212 Transcribed locus Mapping Information SHGC-32243 Sequence Map: Chr 13|HuRef Map Viewer   Position: 10900331-10900455 (bp)   SHGC-32243 Sequence Map: Chr 13|Celera Map Viewer   Position: 11155567-11155691 (bp)   SHGC-32243 Sequence Map: Chr 13 Map Viewer   Position: 28977933-28978057 (bp)   SGC32243 NCBI RH Map: Chr 13 Map Viewer   Position: 218.5 (cR)   Lod score: 1.41   SGC32243 Whitehead-RH Map: Chr 13 Map Viewer   Position: 76.1 (cR3000)   Lod score: P0.40   SHGC-32243 GeneMap99-G3 Map: Chr 13 Map Viewer   Position: 257 (cR10000)   Lod score: 0.34   Reference Interval: D13S1244-D13S260   SGC32243 GeneMap99-GB4 Map: Chr 13 Map Viewer   Position: 88.16 (cR3000)   Lod score: 0.85   Reference Interval: D13S1244-D13S260 Electronic PCR results RefSeq mRNA (2) NM_001033602.2 6788 .. 6912 (125 bp)   NM_015233.5 3840 .. 3964 (125 bp)     Genomic (5 of 10)[Show All Hits] G25758.1 16 .. 140 (125 bp)   G27458.1 16 .. 140 (125 bp)   Z73332.1 76 .. 199 (124 bp)   AL596114.10 75406 .. 75530 (125 bp)   CH003460.1 10693734 .. 10693858 (125 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AL353601.14 76163 .. 76287 (125 bp)   AL391599.9 28629 .. 28753 (125 bp)     ESTs (5 of 10)[Show All Hits] T26932.1 16 .. 140 (125 bp)   R41801.1 32 .. 156 (125 bp)   AA021163.1 58 .. 182 (125 bp)   AA443334.1 24 .. 148 (125 bp)   AA962508.1 23 .. 147 (125 bp)     Whole Genome Shotgun sequences (4) AADD01130356.1 1344 .. 1468 (125 bp)   AADC01111974.1 3873 .. 3997 (125 bp)   AADB02015943.1 1817631 .. 1817755 (125 bp)   ABBA01035713.1 51778 .. 51902 (125 bp)        Pan troglodytes Name: SHGC-32243 Polymorphism info:   Mapping Information SHGC-32243 Sequence Map: Chr 13 Map Viewer   Position: 29199053-29199177 (bp) Electronic PCR results Genomic (1) CM000327.1 29199053 .. 29199177 (125 bp)     Whole Genome Shotgun sequences (1) AACZ02141760.1 497 .. 621 (125 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement