PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:29637 Links D1S2726 Homo sapiens chromosome 1, polymorphic Pan troglodytes chromosome 1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CCACAAGTTGCAGGGTT Reverse primer: CTGGATGGATGCTCAAATAC PCR product size: 276-288 (bp), Homo sapiens GenBank Accession: Z53160    Homo sapiens Name: D1S2726 Also known as: AFMb032yd1 B032YD1 GDB:602705 GDB:609537 HSB032YD1 SHGC-19916 W6239 stSG14413 Polymorphism info: on genetic map Cross References Mapping Information D1S2726 Sequence Map: Chr 1|HuRef Map Viewer   Position: 109055652-109055929 (bp)   D1S2726 Sequence Map: Chr 1|Celera Map Viewer   Position: 109431373-109431650 (bp)   D1S2726 Sequence Map: Chr 1 Map Viewer   Position: 110985788-110986065 (bp)   D1S2726 deCODE Map: Chr 1 Map Viewer   Position: 132.11 (cM)   AFMb032yd1 Genethon Map: Chr 1 Map Viewer   Position: 149.00 (cM)   AFMb032yd1 Marshfield Map: Chr 1 Map Viewer   Position: 144.38 (cM)   AFMb032yd1 NCBI RH Map: Chr 1 Map Viewer   Position: 845.7 (cR)   Lod score: 2.01   SHGC-19916 TNG Map: Chr 1 Map Viewer   Position: 48312 (cR50000)   Lod score: 15   Reference Interval: 113   AFMb032yd1 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 351.98 (cR3000)   Lod score: F   Reference Interval: D1S2865-D1S418   D1S2726 Whitehead-YAC Map: Chr 1 Map Viewer   Reference Interval: WC1.16 Electronic PCR results Genomic (5 of 8)[Show All Hits] Z53160.1 77 .. 354 (278 bp)   AL365361.12 88513 .. 88790 (278 bp)   CH003448.1 110193908 .. 110194185 (278 bp)   CH003496.1 111335119 .. 111335396 (278 bp)   CH471122.1 2149584 .. 2149861 (278 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AL513469.1 33846 .. 34123 (278 bp)     Whole Genome Shotgun sequences (4) AADD01007614.1 30857 .. 31134 (278 bp)   AADC01006113.1 32140 .. 32417 (278 bp)   AADB02000764.1 272667 .. 272944 (278 bp)   ABBA01068393.1 182220 .. 182497 (278 bp)        Pan troglodytes Name: D1S2726 Polymorphism info:   Mapping Information D1S2726 Sequence Map: Chr 1 Map Viewer   Position: 127129194-127129455 (bp) Electronic PCR results Genomic (1) CM000314.1 127129194 .. 127129455 (262 bp)     Whole Genome Shotgun sequences (2) AADA01232353.1 1036 .. 1297 (262 bp)   AACZ02008908.1 1259 .. 1520 (262 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement