PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:66396 Links WI-15057 Homo sapiens chromosome 19, locus GATAD2A Macaca mulatta chromosome 19, locus LOC721223 Pan troglodytes chromosome 19, locus GATAD2A Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCCCACCCCAAAAAACATC Reverse primer: TTGTTTTTTTGTGCATAACTTGG PCR product size: 125 (bp), Homo sapiens GenBank Accession: H22983    Homo sapiens Name: WI-15057 Also known as: EST283494 Polymorphism info:   Cross References Gene GeneID: 54815   Symbol: GATAD2A   Description: GATA zinc finger domain containing 2A   Position: 19p13.11 UniGene Hs.118964 Transcribed locus, weakly similar to XP_996602.1 PREDICTED: similar to 60S a...   Hs.696033 GATA zinc finger domain containing 2A Mapping Information WI-15057 Sequence Map: Chr 19|HuRef Map Viewer   Position: 19180017-19180141 (bp)   WI-15057 Sequence Map: Chr 19 Map Viewer   Position: 19478913-19479037 (bp)   WI-15057 Sequence Map: Chr 19|Celera Map Viewer   Position: 19521973-19522097 (bp)   WI-15057 NCBI RH Map: Chr 19 Map Viewer   Position: 177.1 (cR)   Lod score: 1.55   WI-15057 Whitehead-RH Map: Chr 19 Map Viewer   Position: 106.5 (cR3000)   Lod score: P0.47   WI-15057 GeneMap99-GB4 Map: Chr 19 Map Viewer   Position: 105.83 (cR3000)   Lod score: 0.14   Reference Interval: D19S899-D19S407 Electronic PCR results RefSeq mRNA (1) NM_017660.3 3844 .. 3968 (125 bp)     mRNA (3) AK000092.1 2285 .. 2409 (125 bp)   AL390164.1 2063 .. 2187 (125 bp)   AK225198.1 2285 .. 2409 (125 bp)     Genomic (5 of 7)[Show All Hits] AC011448.5 69203 .. 69327 (125 bp)   CH003466.1 19687983 .. 19688107 (125 bp)   CH003514.1 22154221 .. 22154345 (125 bp)   CH471106.1 10738219 .. 10738343 (125 bp)   CM000270.1 19521973 .. 19522097 (125 bp)     ESTs (5 of 29)[Show All Hits] H22983.1 32 .. 156 (125 bp)   N23324.1 25 .. 149 (125 bp)   N36885.1 24 .. 148 (125 bp)   W03044.1 25 .. 149 (125 bp)   AA074468.1 25 .. 149 (125 bp)     Whole Genome Shotgun sequences (4) AADD01164058.1 34559 .. 34683 (125 bp)   AADC01137929.1 104511 .. 104635 (125 bp)   AADB02020096.1 781590 .. 781714 (125 bp)   ABBA01051333.1 52702 .. 52826 (125 bp)        Macaca mulatta Name: WI-15057 Polymorphism info:   Cross References Gene GeneID: 721223   Symbol: LOC721223   Description: similar to GATA zinc finger domain containing 2A   Position:   Mapping Information WI-15057 Sequence Map: Chr 19|NW_001107509.1 Map Viewer   Position: 58762-58886 (bp)    Pan troglodytes Name: WI-15057 Polymorphism info:   Cross References Gene GeneID: 455876   Symbol: GATAD2A   Description: GATA zinc finger domain containing 2A   Position:   Mapping Information WI-15057 Sequence Map: Chr 19 Map Viewer   Position: 20005260-20005385 (bp) Electronic PCR results RefSeq mRNA (1) XM_512527.2 3900 .. 4025 (126 bp)     Genomic (3) CM000333.1 20005260 .. 20005385 (126 bp)   AC190130.4 42665 .. 42790 (126 bp)   AC195296.3 36135 .. 36260 (126 bp)     Whole Genome Shotgun sequences (2) AADA01258187.1 21 .. 146 (126 bp)   AACZ02183613.1 2676 .. 2801 (126 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement