PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:22304 Links SHGC-30444 Homo sapiens chromosome 2, locus KCNH7 Macaca mulatta chromosome 12, locus LOC702259 Pan troglodytes chromosome 2B, locus KCNH7 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAAAGCTGGTGATTCCGG Reverse primer: GCAACGTCTTGAAGAATATTTCC PCR product size: 150 (bp), Homo sapiens GenBank Accession: F02206 G22400    Homo sapiens Name: SHGC-30444 Also known as: EST100704 SGC30444 WI-30444 Polymorphism info:   Cross References Gene GeneID: 90134   Symbol: KCNH7   Description: potassium voltage-gated channel, subfamily H (eag-related), member 7   Position: 2q24.2 UniGene Hs.657413 Potassium voltage-gated channel, subfamily H (eag-related), member 7 Mapping Information SHGC-30444 Sequence Map: Chr 2|HuRef Map Viewer   Position: 155162354-155162504 (bp)   SHGC-30444 Sequence Map: Chr 2|Celera Map Viewer   Position: 156890091-156890241 (bp)   SHGC-30444 Sequence Map: Chr 2 Map Viewer   Position: 162988005-162988155 (bp)   SHGC-30444 NCBI RH Map: Chr 2 Map Viewer   Position: 1187.1 (cR)   Lod score: 2.82   SHGC-30444 TNG Map: Chr 2 Map Viewer   Position: 92607 (cR50000)   Lod score: 7.5   Reference Interval: 282   SHGC-30444 Stanford-G3 Map: Chr 2 Map Viewer   Position: 6677 (cR10000)   Lod score: F   Reference Interval: 92   SGC30444 Whitehead-RH Map: Chr 2 Map Viewer   Position: 817.3 (cR3000)   Lod score: P1.33   SHGC-30444 GeneMap99-G3 Map: Chr 2 Map Viewer   Position: 7538 (cR10000)   Lod score: F   Reference Interval: D2S156-D2S376   SGC30444 GeneMap99-GB4 Map: Chr 2 Map Viewer   Position: 543.17 (cR3000)   Lod score: 1.90   Reference Interval: D2S156-D2S376 Electronic PCR results RefSeq mRNA (1) NM_173162.1 2282 .. 2432 (151 bp)     mRNA (1) BC035815.1 2282 .. 2432 (151 bp)     Genomic (5 of 8)[Show All Hits] G22400.1 1 .. 150 (150 bp)   AC007740.2 46406 .. 46556 (151 bp)   CH003449.1 154283684 .. 154283834 (151 bp)   CH003497.1 165257909 .. 165258059 (151 bp)   CH471058.2 31079894 .. 31080044 (151 bp)     ESTs (1) F02206.1 1 .. 150 (150 bp)     Whole Genome Shotgun sequences (4) AADD01024316.1 9485 .. 9635 (151 bp)   AADC01021156.1 449137 .. 449287 (151 bp)   AADB02002483.1 415254 .. 415404 (151 bp)   ABBA01004894.1 20802 .. 20952 (151 bp)        Macaca mulatta Name: SHGC-30444 Polymorphism info:   Cross References Gene GeneID: 702259   Symbol: LOC702259   Description: similar to potassium voltage-gated channel, subfamily H, member 7 isoform 2   Position:   Mapping Information SHGC-30444 Sequence Map: Chr 12 Map Viewer   Position: 25996223-25996373 (bp)    Pan troglodytes Name: SHGC-30444 Polymorphism info:   Cross References Gene GeneID: 470573   Symbol: KCNH7   Description: potassium voltage-gated channel, subfamily H (eag-related), member 7   Position:   Mapping Information SHGC-30444 Sequence Map: Chr 2B Map Viewer   Position: 167136660-167136810 (bp) Electronic PCR results RefSeq mRNA (1) XM_001151098.1 2371 .. 2521 (151 bp)     Genomic (1) CM000316.1 167136660 .. 167136810 (151 bp)     Whole Genome Shotgun sequences (2) AADA01018339.1 7551 .. 7701 (151 bp)   AACZ02027679.1 12042 .. 12192 (151 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement