PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:65438 Links RH11453 Homo sapiens chromosome 1, loci FCGR3B and FCGR3A Pan troglodytes chromosome 1, locus FCGR3B Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCATCCTCAGGCCTCTCTACA Reverse primer: TGCTTTGCTGTGAGGGAAC PCR product size: 214 (bp), Homo sapiens    Homo sapiens Name: RH11453 Also known as: stSG71 Polymorphism info:   Cross References Gene GeneID: 2214   Symbol: FCGR3A   Description: Fc fragment of IgG, low affinity IIIa, receptor (CD16a)   Position: 1q23 Gene GeneID: 2215   Symbol: FCGR3B   Description: Fc fragment of IgG, low affinity IIIb, receptor (CD16b)   Position: 1q23 UniGene Hs.372679 Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Mapping Information RH11453 Sequence Map: Chr Un|NW_927285.1|Celera Map Viewer   Position: 2105-2318 (bp)   RH11453 Sequence Map: Chr 1|HuRef Map Viewer   Position: 132837662-132837875 (bp)   RH11453 Sequence Map: Chr 1 Map Viewer   Position: 159779140-159779353 (bp)   RH11453 Sequence Map: Chr 1 Map Viewer   Position: 159860580-159860793 (bp)   stSG71 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 576.12 (cR3000)   Lod score: 2.30   Reference Interval: D1S2635-D1S2844 Electronic PCR results RefSeq mRNA (2) NM_000569.6 1130 .. 1343 (214 bp)   NM_000570.3 1112 .. 1325 (214 bp)     mRNA (5) M24853.1 748 .. 961 (214 bp)   BC033678.1 861 .. 1074 (214 bp)   BC036723.1 1130 .. 1343 (214 bp)   AK223268.1 854 .. 1067 (214 bp)   AK223295.1 866 .. 1079 (214 bp)     Genomic (5 of 6)[Show All Hits] CH003448.1 134411187 .. 134411400 (214 bp)   AL590385.23 99385 .. 99598 (214 bp)   AL451067.12 7429 .. 7642 (214 bp)   AL451067.12 88866 .. 89079 (214 bp)   DS486107.1 8072570 .. 8072783 (214 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC021370.4 47650 .. 47863 (214 bp)   AC021370.4 119138 .. 119351 (214 bp)   BX537284.3 124639 .. 124852 (214 bp)     ESTs (5 of 16)[Show All Hits] R93404.1 64 .. 277 (214 bp)   R93453.1 63 .. 277 (215 bp)   W88619.1 77 .. 291 (215 bp)   W88680.1 64 .. 278 (215 bp)   AA367976.1 89 .. 301 (213 bp)     Whole Genome Shotgun sequences (3) AADD01009239.1 14355 .. 14568 (214 bp)   AADB02165210.1 2105 .. 2318 (214 bp)   ABBA01047317.1 6246 .. 6459 (214 bp)        Pan troglodytes Name: RH11453 Polymorphism info:   Cross References Gene GeneID: 745350   Symbol: FCGR3B   Description: Fc fragment of IgG, low affinity IIIb, receptor (CD16b)   Position:   Mapping Information RH11453 Sequence Map: Chr 1|NW_001229223.1 Map Viewer   Position: 45570-45783 (bp) Electronic PCR results RefSeq mRNA (2) XM_001159557.1 1276 .. 1489 (214 bp)   XM_001159595.1 1057 .. 1270 (214 bp)     Genomic (1) CH701137.1 45570 .. 45783 (214 bp)     Whole Genome Shotgun sequences (2) AADA01191348.1 17189 .. 17402 (214 bp)   AACZ02016929.1 575 .. 788 (214 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement