|
![](IMG/pix_tr.gif) |
UniSTS:42512 |
Links |
RH68551 |
Bos taurus chromosome 5, locus COL2A1 |
Canis familiaris chromosome 27, locus COL2A1 |
Equus caballus chromosome 6, locus COL2A1 |
Homo sapiens chromosome 12, loci HNRNPM and COL2A1 |
Macaca mulatta chromosome 11, locus LOC704851 |
Pan troglodytes chromosome 12, locus COL2A1 |
Found by e-PCR in sequences from Bos taurus, Canis familiaris, Homo sapiens, Ovis aries, Pan troglodytes and Sus scrofa. |
Primer Information | ![Help](IMG/whatisit-20.png) |
Forward primer: | GAATAGCACCATTGTGTAGGAC |
Reverse primer: | AATGCCCCCTGAGTGAC |
PCR product size: | 97 (bp), Homo sapiens |
GenBank Accession: | H62235
|
Name: |
RH68551 |
Polymorphism info: |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
Gene |
GeneID: | 407142 |
| Symbol: | COL2A1 |
| Description: | collagen, type II, alpha 1 |
| Position: | |
UniGene | Bt.21390 |
Collagen, type II, alpha 1 |
![](/genome/guide/corehtml/darkgray.gif) |
Mapping Information | ![Help](IMG/whatisit-20.png) |
RH68551 |
Sequence Map: |
Chr 5 |
Map Viewer |
|
Position: |
35497934-35498028 (bp) |
![](/genome/guide/corehtml/darkgray.gif) |
Electronic PCR results |
![Help](IMG/whatisit-20.png) |
RefSeq mRNA (2) |
NM_001001135.2 |
4761 .. 4855 (95 bp) |
NM_001113224.1 |
4709 .. 4803 (95 bp) |
|
Genomic (2) |
AY743675.1 |
30219 .. 30313 (95 bp) |
CM000181.3 |
35497934 .. 35498028 (95 bp) |
|
Working Draft phase 1 (from GenBank HTGS division) (2) |
AC158832.2 |
66313 .. 66407 (95 bp) |
AC149699.4 |
172722 .. 172816 (95 bp) |
|
ESTs (5 of 35)[Show All Hits] |
AW345461.1 |
38 .. 132 (95 bp) |
AW346355.1 |
38 .. 132 (95 bp) |
AW359137.1 |
37 .. 131 (95 bp) |
AW479345.1 |
38 .. 132 (95 bp) |
BE237541.1 |
5 .. 99 (95 bp) |
|
BAC-ends (1) |
CR805282.1 |
592 .. 686 (95 bp) |
|
Whole Genome Shotgun sequences (1) |
AAFC03056593.1 |
28420 .. 28514 (95 bp) |
|
Name: |
RH68551 |
Polymorphism info: |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
Gene |
GeneID: | 403826 |
| Symbol: | COL2A1 |
| Description: | collagen, type II, alpha 1 |
| Position: | |
![](/genome/guide/corehtml/darkgray.gif) |
Mapping Information | ![Help](IMG/whatisit-20.png) |
RH68551 |
Sequence Map: |
Chr 27 |
Map Viewer |
|
Position: |
9799082-9799178 (bp) |
![](/genome/guide/corehtml/darkgray.gif) |
Electronic PCR results |
![Help](IMG/whatisit-20.png) |
RefSeq mRNA (1) |
NM_001006951.1 |
4757 .. 4853 (97 bp) |
|
mRNA (1) |
AF023169.2 |
4757 .. 4853 (97 bp) |
|
Genomic (1) |
CM000027.2 |
9799082 .. 9799178 (97 bp) |
|
ESTs (5 of 6)[Show All Hits] |
CO599523.1 |
70 .. 166 (97 bp) |
CO600850.1 |
72 .. 168 (97 bp) |
CO619019.1 |
69 .. 165 (97 bp) |
CO631183.1 |
72 .. 168 (97 bp) |
DN879265.1 |
90 .. 186 (97 bp) |
|
Whole Genome Shotgun sequences (2) |
AACN010517532.1 |
196 .. 292 (97 bp) |
AAEX02010867.1 |
26963 .. 27059 (97 bp) |
|
Name: |
RH68551 |
Polymorphism info: |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
Gene |
GeneID: | 791241 |
| Symbol: | COL2A1 |
| Description: | collagen, type II, alpha 1 |
| Position: | |
UniGene | Eca.5282 |
Collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dyspl... |
![](/genome/guide/corehtml/darkgray.gif) |
Mapping Information | ![Help](IMG/whatisit-20.png) |
RH68551 |
Sequence Map: |
Chr 6 |
Map Viewer |
|
Position: |
65628853-65628952 (bp) |
Name: |
RH68551 |
Also known as: |
H62235 |
Polymorphism info: |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
Gene |
GeneID: | 1280 |
| Symbol: | COL2A1 |
| Description: | collagen, type II, alpha 1 |
| Position: | 12q13.11 |
Gene |
GeneID: | 4670 |
| Symbol: | HNRNPM |
| Description: | heterogeneous nuclear ribonucleoprotein M |
| Position: | 19p13.3-p13.2 |
UniGene | Hs.408182 |
Collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dyspl... |
| Hs.465808 |
Heterogeneous nuclear ribonucleoprotein M |
| Hs.703845 |
Transcribed locus |
![](/genome/guide/corehtml/darkgray.gif) |
Mapping Information | ![Help](IMG/whatisit-20.png) |
RH68551 |
Sequence Map: |
Chr 12|HuRef |
Map Viewer |
|
Position: |
45398659-45398755 (bp) |
|
RH68551 |
Sequence Map: |
Chr 12 |
Map Viewer |
|
Position: |
46653086-46653182 (bp) |
|
RH68551 |
Sequence Map: |
Chr 12|Celera |
Map Viewer |
|
Position: |
47164467-47164563 (bp) |
|
H62235 |
NCBI RH Map: |
Chr 12 |
Map Viewer |
|
Position: |
357.8 (cR) |
|
Lod score: |
1.14 |
|
H62235 |
GeneMap99-GB4 Map: |
Chr 12 |
Map Viewer |
|
Position: |
211.47 (cR3000) |
|
Lod score: |
0.29 |
|
Reference Interval: |
D12S333-D12S325 |
![](/genome/guide/corehtml/darkgray.gif) |
Electronic PCR results |
![Help](IMG/whatisit-20.png) |
RefSeq mRNA (2) |
NM_033150.2 |
4713 .. 4809 (97 bp) |
NM_001844.4 |
4920 .. 5016 (97 bp) |
|
mRNA (3) |
X06268.1 |
1217 .. 1313 (97 bp) |
BC007252.1 |
1415 .. 1511 (97 bp) |
BC116449.1 |
4741 .. 4837 (97 bp) |
|
Genomic (5 of 9)[Show All Hits] |
X02670.1 |
278 .. 374 (97 bp) |
G06343.1 |
275 .. 371 (97 bp) |
AC004801.2 |
166049 .. 166145 (97 bp) |
CH003459.1 |
45597020 .. 45597116 (97 bp) |
CH003507.1 |
37685756 .. 37685852 (97 bp) |
|
ESTs (5 of 201)[Show All Hits] |
R06403.1 |
72 .. 168 (97 bp) |
R09767.1 |
61 .. 157 (97 bp) |
R64593.1 |
59 .. 155 (97 bp) |
R92016.1 |
32 .. 128 (97 bp) |
R92693.1 |
37 .. 133 (97 bp) |
|
Whole Genome Shotgun sequences (4) |
AADD01123681.1 |
14312 .. 14408 (97 bp) |
AADC01105170.1 |
83093 .. 83189 (97 bp) |
AADB02014854.1 |
39708 .. 39804 (97 bp) |
ABBA01031473.1 |
83813 .. 83909 (97 bp) |
|
Name: |
RH68551 |
Polymorphism info: |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
Gene |
GeneID: | 704851 |
| Symbol: | LOC704851 |
| Description: | similar to alpha 1 type II collagen isoform 1 |
| Position: | |
UniGene | Mmu.16004 |
Similar to alpha 1 type II collagen isoform 1 |
![](/genome/guide/corehtml/darkgray.gif) |
Mapping Information | ![Help](IMG/whatisit-20.png) |
RH68551 |
Sequence Map: |
Chr 11 |
Map Viewer |
|
Position: |
45045844-45045940 (bp) |
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
UniGene | Oar.5020 |
Transcribed locus, strongly similar to NP_037061.1 procollagen, type II, alp... |
![](/genome/guide/corehtml/darkgray.gif) |
Electronic PCR results |
![Help](IMG/whatisit-20.png) |
ESTs (2) |
DY487766.1 |
110 .. 205 (96 bp) |
EE794584.1 |
303 .. 398 (96 bp) |
|
Name: |
RH68551 |
Polymorphism info: |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
Gene |
GeneID: | 451860 |
| Symbol: | COL2A1 |
| Description: | collagen, type II, alpha 1 |
| Position: | |
![](/genome/guide/corehtml/darkgray.gif) |
Mapping Information | ![Help](IMG/whatisit-20.png) |
RH68551 |
Sequence Map: |
Chr 12 |
Map Viewer |
|
Position: |
41763511-41763607 (bp) |
![](/genome/guide/corehtml/darkgray.gif) |
Electronic PCR results |
![Help](IMG/whatisit-20.png) |
RefSeq mRNA (5 of 6)[Show All Hits] |
XM_509026.2 |
4904 .. 5000 (97 bp) |
XM_001161825.1 |
4713 .. 4809 (97 bp) |
XM_001161790.1 |
4688 .. 4784 (97 bp) |
XM_001161566.1 |
4785 .. 4881 (97 bp) |
XM_001161752.1 |
4979 .. 5075 (97 bp) |
|
Genomic (1) |
CM000326.1 |
41763511 .. 41763607 (97 bp) |
|
Whole Genome Shotgun sequences (2) |
AADA01056336.1 |
8375 .. 8471 (97 bp) |
AACZ02134197.1 |
33625 .. 33721 (97 bp) |
|
![](/genome/guide/corehtml/darkgray.gif) |
Cross References |
![Help](IMG/whatisit-20.png) |
UniGene | Ssc.51118 |
Transcribed locus, strongly similar to NP_149162.1 alpha 1 type II collagen ... |
![](/genome/guide/corehtml/darkgray.gif) |
Electronic PCR results |
![Help](IMG/whatisit-20.png) |
ESTs (5 of 199)[Show All Hits] |
CK450832.1 |
72 .. 168 (97 bp) |
CK459619.1 |
551 .. 647 (97 bp) |
CK459968.1 |
75 .. 171 (97 bp) |
CN166132.1 |
73 .. 169 (97 bp) |
DN120768.1 |
473 .. 569 (97 bp) |
|
|