ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:32007 Links
WI-14959
Homo sapiens chromosome 5, locus NSD1
Macaca mulatta chromosome 6, locus LOC706131
Pan troglodytes chromosome 5, locus NSD1

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:CCCTCCCCACTGAAGAAAAG
Reverse primer:CCAGCAAGACTGTGCCAGT
PCR product size:125 (bp), Homo sapiens
GenBank Accession:G24268 H18358

   Homo sapiens
Name: WI-14959
Also known as: EST278296
Polymorphism info:  

Cross References Help
Gene GeneID:64324
 Symbol:NSD1
 Description:nuclear receptor binding SET domain protein 1
 Position:5q35.2-q35.3
UniGeneHs.654666 Nuclear receptor binding SET domain protein 1

Mapping InformationHelp
WI-14959 Sequence Map: Chr 5|HuRef Map Viewer
  Position: 171642930-171643054 (bp)
 
WI-14959 Sequence Map: Chr 5|Celera Map Viewer
  Position: 171779042-171779166 (bp)
 
WI-14959 Sequence Map: Chr 5 Map Viewer
  Position: 176654801-176654925 (bp)
 
WI-14959 NCBI RH Map: Chr 5 Map Viewer
  Position: 973 (cR)
  Lod score: 2.44
 
WI-14959 Whitehead-RH Map: Chr 5 Map Viewer
  Position: 540.9 (cR3000)
  Lod score: P>3.00
 
WI-14959 GeneMap99-GB4 Map: Chr 5 Map Viewer
  Position: 636.91 (cR3000)
  Lod score: 0.02
  Reference Interval: D5S504-D5S677

Electronic PCR results Help
RefSeq mRNA (2)
NM_022455.4 7964 .. 8088 (125 bp)  
NM_172349.2 7179 .. 7303 (125 bp)  
 
mRNA (5 of 6)[Show All Hits]
AF085858.1 76 .. 200 (125 bp)  
AK025916.1 1918 .. 2042 (125 bp)  
AK026066.1 3081 .. 3205 (125 bp)  
AY049721.1 7844 .. 7968 (125 bp)  
AF380302.1 7120 .. 7244 (125 bp)  
 
Genomic (5 of 10)[Show All Hits]
G24268.1 25 .. 149 (125 bp)  
AC110005.2 80137 .. 80261 (125 bp)  
AC146507.2 60991 .. 61115 (125 bp)  
AY406917.1 7019 .. 7143 (125 bp)  
CH003452.1 173969712 .. 173969836 (125 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (3)
AC140129.1 348801 .. 348925 (125 bp)  
AC145096.1 117424 .. 117548 (125 bp)  
AC145097.1 195853 .. 195977 (125 bp)  
 
ESTs (5 of 18)[Show All Hits]
H18358.1 25 .. 149 (125 bp)  
AW406596.1 13 .. 137 (125 bp)  
AW601968.1 165 .. 289 (125 bp)  
AW601969.1 166 .. 290 (125 bp)  
BE079259.1 73 .. 197 (125 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01066151.1 15434 .. 15558 (125 bp)  
AADC01057297.1 1128 .. 1252 (125 bp)  
AADB02009780.1 16016 .. 16140 (125 bp)  
ABBA01033458.1 45401 .. 45525 (125 bp)  
 

   Macaca mulatta
Name: WI-14959
Polymorphism info:  

Cross References Help
Gene GeneID:706131
 Symbol:LOC706131
 Description:similar to nuclear receptor binding SET domain protein 1 isoform b
 Position: 
UniGeneMmu.13585 Similar to nuclear receptor binding SET domain protein 1 isoform b

Mapping InformationHelp
WI-14959 Sequence Map: Chr 6 Map Viewer
  Position: 173817747-173817871 (bp)

   Pan troglodytes
Name: WI-14959
Polymorphism info:  

Cross References Help
Gene GeneID:471754
 Symbol:NSD1
 Description:nuclear receptor binding SET domain protein 1
 Position: 

Mapping InformationHelp
WI-14959 Sequence Map: Chr 5 Map Viewer
  Position: 179675944-179676068 (bp)

Electronic PCR results Help
RefSeq mRNA (5 of 7)[Show All Hits]
XM_001139598.1 7974 .. 8098 (125 bp)  
XM_527132.2 7967 .. 8091 (125 bp)  
XM_001139204.1 8123 .. 8247 (125 bp)  
XM_001139281.1 7658 .. 7782 (125 bp)  
XM_001139359.1 7130 .. 7254 (125 bp)  
 
Genomic (1)
CM000319.1 179675944 .. 179676068 (125 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01282457.1 3945 .. 4069 (125 bp)  
AACZ02066749.1 3943 .. 4067 (125 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement