PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:43543 Links A006A39 Homo sapiens chromosome 5, locus ADAMTS16 Pan troglodytes chromosome 5, locus ADAMTS16 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GACTACACTTTGAGAAGTGT Reverse primer: CTTAGGAGCTGTGTGTACTA PCR product size: 104 (bp), Homo sapiens    Homo sapiens Name: A006A39 Also known as: Polymorphism info:   Cross References Gene GeneID: 170690   Symbol: ADAMTS16   Description: ADAM metallopeptidase with thrombospondin type 1 motif, 16   Position: 5p15 Mapping Information A006A39 Sequence Map: Chr 5|HuRef Map Viewer   Position: 5232039-5232142 (bp)   A006A39 Sequence Map: Chr 5|Celera Map Viewer   Position: 5284696-5284799 (bp)   A006A39 Sequence Map: Chr 5 Map Viewer   Position: 5311387-5311490 (bp)   A006A39 NCBI RH Map: Chr 5 Map Viewer   Position: 10 (cR)   Lod score: 1.28   A006A39 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 28.06 (cR3000)   Lod score: 0.02   Reference Interval: D5S406-D5S464 Electronic PCR results Genomic (5 of 9)[Show All Hits] G20661.1 1 .. 104 (104 bp)   AC010269.6 164198 .. 164301 (104 bp)   AC091978.3 34074 .. 34177 (104 bp)   CH003452.1 5379311 .. 5379414 (104 bp)   CH003500.1 5811231 .. 5811334 (104 bp)     ESTs (5 of 9)[Show All Hits] F07361.1 83 .. 186 (104 bp)   F07380.1 82 .. 185 (104 bp)   T77954.1 79 .. 182 (104 bp)   R14405.1 82 .. 185 (104 bp)   R14944.1 82 .. 185 (104 bp)     Whole Genome Shotgun sequences (4) AADD01055419.1 28800 .. 28903 (104 bp)   AADC01048613.1 546724 .. 546827 (104 bp)   AADB02008306.1 46556 .. 46659 (104 bp)   ABBA01016135.1 28797 .. 28900 (104 bp)        Pan troglodytes Name: A006A39 Polymorphism info:   Cross References Gene GeneID: 471451   Symbol: ADAMTS16   Description: ADAM metallopeptidase with thrombospondin type 1 motif, 16   Position:   Mapping Information A006A39 Sequence Map: Chr 5 Map Viewer   Position: 5382357-5382460 (bp) Electronic PCR results Genomic (1) CM000319.1 5382357 .. 5382460 (104 bp)     Whole Genome Shotgun sequences (2) AADA01312862.1 488 .. 591 (104 bp)   AACZ02057864.1 10606 .. 10709 (104 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement