PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:24446 Links SHGC-4171 Homo sapiens chromosome 2, locus HEATR5B Pan troglodytes chromosome 2A, locus HEATR5B Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CACCACAAAACAGACACTTTC Reverse primer: CAATTGTATCATGTAGTCGGG PCR product size: 154 (bp), Homo sapiens GenBank Accession: T17419    Homo sapiens Name: SHGC-4171 Also known as: NIB883 STS-T17419 sts-T17419 Polymorphism info:   Cross References Gene GeneID: 54497   Symbol: HEATR5B   Description: HEAT repeat containing 5B   Position: 2p22.2 UniGene Hs.468186 Transcribed locus   Hs.591564 HEAT repeat containing 5B Mapping Information SHGC-4171 Sequence Map: Chr 2|HuRef Map Viewer   Position: 36948443-36948596 (bp)   SHGC-4171 Sequence Map: Chr 2|Celera Map Viewer   Position: 37049209-37049362 (bp)   SHGC-4171 Sequence Map: Chr 2 Map Viewer   Position: 37061693-37061846 (bp)   NIB883 NCBI RH Map: Chr 2 Map Viewer   Position: 271.1 (cR)   Lod score: 1.67   SHGC-4171 TNG Map: Chr 2 Map Viewer   Position: 78979 (cR50000)   Lod score: 4.1   Reference Interval: 242   NIB883 Whitehead-RH Map: Chr 2 Map Viewer   Position: 177.8 (cR3000)   Lod score: P>3.00   SHGC-4171 GeneMap99-G3 Map: Chr 2 Map Viewer   Position: 1551 (cR10000)   Lod score: 0.88   Reference Interval: D2S2230-D2S177   NIB883 GeneMap99-GB4 Map: Chr 2 Map Viewer   Position: 117.23 (cR3000)   Lod score: 0.80   Reference Interval: D2S2230-D2S177   sts-T17419 GeneMap99-GB4 Map: Chr 2 Map Viewer   Position: 117.23 (cR3000)   Lod score: 0.80   Reference Interval: D2S2230-D2S177 Electronic PCR results RefSeq mRNA (1) NM_019024.1 6603 .. 6756 (154 bp)     mRNA (5 of 6)[Show All Hits] AK001513.1 2046 .. 2199 (154 bp)   AB037835.1 5053 .. 5206 (154 bp)   AK026928.1 2866 .. 3019 (154 bp)   AL832880.1 2008 .. 2161 (154 bp)   BX538008.1 5529 .. 5682 (154 bp)     Genomic (5 of 7)[Show All Hits] AC007404.4 92011 .. 92164 (154 bp)   CH003449.1 36868937 .. 36869090 (154 bp)   CH003497.1 39085008 .. 39085161 (154 bp)   CH471053.2 36981144 .. 36981297 (154 bp)   CM000253.1 37049209 .. 37049362 (154 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC073168.1 49428 .. 49581 (154 bp)     ESTs (5 of 47)[Show All Hits] T17419.1 33 .. 186 (154 bp)   Z41197.1 33 .. 186 (154 bp)   F09206.1 33 .. 186 (154 bp)   F09207.1 33 .. 186 (154 bp)   T99540.1 43 .. 196 (154 bp)     Whole Genome Shotgun sequences (4) AADD01016930.1 1862 .. 2015 (154 bp)   AADC01014872.1 660698 .. 660851 (154 bp)   AADB02001667.1 1450603 .. 1450756 (154 bp)   ABBA01074970.1 51723 .. 51876 (154 bp)        Pan troglodytes Name: SHGC-4171 Polymorphism info:   Cross References Gene GeneID: 459152   Symbol: HEATR5B   Description: HEAT repeat containing 5B   Position:   Mapping Information SHGC-4171 Sequence Map: Chr 2A Map Viewer   Position: 37800018-37800169 (bp) Electronic PCR results RefSeq mRNA (1) XM_515406.2 6600 .. 6751 (152 bp)     Genomic (1) CM000315.1 37800018 .. 37800169 (152 bp)     Whole Genome Shotgun sequences (2) AADA01238246.1 5858 .. 6009 (152 bp)   AACZ02019915.1 9907 .. 10058 (152 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement