PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:62238 Links A005U41 Homo sapiens chromosome 4, locus KDR Macaca mulatta chromosome 5, locus KDR Pan troglodytes chromosome 4, locus KDR Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TAGCATGTCTTATAGTCATT Reverse primer: CACTCTCTGAATGATTATTA PCR product size: 206 (bp), Homo sapiens    Homo sapiens Name: A005U41 Also known as: Polymorphism info:   Cross References Gene GeneID: 3791   Symbol: KDR   Description: kinase insert domain receptor (a type III receptor tyrosine kinase)   Position: 4q11-q12 UniGene Hs.479756 Kinase insert domain receptor (a type III receptor tyrosine kinase) Mapping Information A005U41 Sequence Map: Chr 4|HuRef Map Viewer   Position: 51893408-51893613 (bp)   A005U41 Sequence Map: Chr 4|Celera Map Viewer   Position: 53446736-53446941 (bp)   A005U41 Sequence Map: Chr 4 Map Viewer   Position: 55639578-55639783 (bp)   A005U41 NCBI RH Map: Chr 4 Map Viewer   Position: 580.8 (cR)   Lod score: 3.90   A005U41 GeneMap99-GB4 Map: Chr 4 Map Viewer   Position: 316.26 (cR3000)   Lod score: 0.08   Reference Interval: D4S1577-D4S1594 Electronic PCR results RefSeq mRNA (1) NM_002253.1 5453 .. 5658 (206 bp)     mRNA (2) AF035121.1 5453 .. 5658 (206 bp)   AB209901.1 5439 .. 5644 (206 bp)     Genomic (5 of 7)[Show All Hits] G20520.1 1 .. 206 (206 bp)   AC111194.4 131378 .. 131583 (206 bp)   CH003451.1 52100542 .. 52100747 (206 bp)   CH471057.1 3271710 .. 3271915 (206 bp)   CM000255.1 53446736 .. 53446941 (206 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC013745.3 57065 .. 57270 (206 bp)     ESTs (5 of 48)[Show All Hits] F09283.1 68 .. 273 (206 bp)   F10490.1 68 .. 273 (206 bp)   R42935.1 79 .. 285 (207 bp)   N55512.1 176 .. 382 (207 bp)   N69251.1 172 .. 377 (206 bp)     Whole Genome Shotgun sequences (3) AADD01045794.1 670 .. 875 (206 bp)   AADB02006728.1 192253 .. 192458 (206 bp)   ABBA01003408.1 15334 .. 15539 (206 bp)        Macaca mulatta Name: A005U41 Polymorphism info:   Cross References Gene GeneID: 698293   Symbol: KDR   Description: kinase insert domain receptor (a type III receptor tyrosine kinase)   Position:   UniGene Mmu.3538 Kinase insert domain receptor (a type III receptor tyrosine kinase) Mapping Information A005U41 Sequence Map: Chr 5 Map Viewer   Position: 74318609-74318814 (bp)    Pan troglodytes Name: A005U41 Polymorphism info:   Cross References Gene GeneID: 461315   Symbol: KDR   Description: kinase insert domain receptor (a type III receptor tyrosine kinase)   Position:   Mapping Information A005U41 Sequence Map: Chr 4 Map Viewer   Position: 75499981-75500186 (bp) Electronic PCR results RefSeq mRNA (1) XM_517284.2 5481 .. 5686 (206 bp)     Genomic (1) CM000318.1 75499981 .. 75500186 (206 bp)     Whole Genome Shotgun sequences (2) AADA01207022.1 1891 .. 2096 (206 bp)   AACZ02049776.1 101206 .. 101411 (206 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement