PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:12036 Links IB3108 Homo sapiens chromosome 11, loci INTS5 and GANAB Macaca mulatta chromosome 14, loci LOC719124 and LOC718672 Pan troglodytes chromosome 11, loci INTS5 and GANAB Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Rattus norvegicus. Primer Information Forward primer: AGAGCAAGAAAAGGCTACGT Reverse primer: CCCTCAGAAGTTCATCTTCC PCR product size: 205 (bp), Homo sapiens GenBank Accession: T16074    Homo sapiens Name: IB3108 Also known as: Polymorphism info:   Cross References Gene GeneID: 23193   Symbol: GANAB   Description: glucosidase, alpha; neutral AB   Position: 11q12.3 Gene GeneID: 80789   Symbol: INTS5   Description: integrator complex subunit 5   Position: 11q12.3 UniGene Hs.458390 Integrator complex subunit 5   Hs.698097 Transcribed locus, weakly similar to NP_085131.1 KIAA1698 protein [Homo sapi... Mapping Information IB3108 Sequence Map: Chr 11|HuRef Map Viewer   Position: 58743374-58743580 (bp)   IB3108 Sequence Map: Chr 11|Celera Map Viewer   Position: 59744024-59744230 (bp)   IB3108 Sequence Map: Chr 11 Map Viewer   Position: 62171054-62171260 (bp)   IB3108 NCBI RH Map: Chr 11 Map Viewer   Position: 558 (cR)   Lod score: 1.62   IB3108 Whitehead-RH Map: Chr 11 Map Viewer   Position: 289.4 (cR3000)   Lod score: P0.01   IB3108 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 229.09 (cR3000)   Lod score: 0.02   Reference Interval: D11S1357-D11S913 Electronic PCR results RefSeq mRNA (1) NM_030628.1 2921 .. 3127 (207 bp)     mRNA (5 of 6)[Show All Hits] AB051485.1 2535 .. 2741 (207 bp)   AK074261.1 2140 .. 2346 (207 bp)   BC028025.1 2310 .. 2516 (207 bp)   AK123587.1 2763 .. 2969 (207 bp)   BC060841.1 2921 .. 3127 (207 bp)     Genomic (5 of 8)[Show All Hits] AP001458.6 54273 .. 54479 (207 bp)   CH003458.1 60914365 .. 60914571 (207 bp)   CH003506.1 61285655 .. 61285861 (207 bp)   BV180436.1 158 .. 364 (207 bp)   CH471076.1 8092100 .. 8092306 (207 bp)     Working Draft phase 1 (from GenBank HTGS division) (5) AP001857.2 12010 .. 12216 (207 bp)   AC087681.3 186211 .. 186417 (207 bp)   AC090306.3 49567 .. 49773 (207 bp)   AC090702.3 33399 .. 33605 (207 bp)   AC090232.5 31300 .. 31506 (207 bp)     ESTs (5 of 42)[Show All Hits] T16074.1 158 .. 364 (207 bp)   AA262395.1 200 .. 406 (207 bp)   AA451751.1 159 .. 365 (207 bp)   AA679407.1 150 .. 354 (205 bp)   AA683352.1 153 .. 359 (207 bp)     Whole Genome Shotgun sequences (4) AADD01116143.1 7324 .. 7530 (207 bp)   AADC01098994.1 3760 .. 3966 (207 bp)   AADB02014085.1 60014 .. 60220 (207 bp)   ABBA01003232.1 9207 .. 9413 (207 bp)        Macaca mulatta Name: IB3108 Polymorphism info:   Cross References Gene GeneID: 718672   Symbol: LOC718672   Description: similar to alpha glucosidase II alpha subunit isoform 2   Position:   Gene GeneID: 719124   Symbol: LOC719124   Description: similar to integrator complex subunit 5   Position:   UniGene Mmu.11870 Similar to integrator complex subunit 5 Mapping Information IB3108 Sequence Map: Chr 14 Map Viewer   Position: 11441428-11441634 (bp)    Pan troglodytes Name: IB3108 Polymorphism info:   Cross References Gene GeneID: 451258   Symbol: GANAB   Description: glucosidase, alpha; neutral AB   Position:   Gene GeneID: 740514   Symbol: INTS5   Description: integrator complex subunit 5   Position:   Mapping Information IB3108 Sequence Map: Chr 11 Map Viewer   Position: 61023151-61023357 (bp) Electronic PCR results RefSeq mRNA (2) XM_001154137.1 2921 .. 3127 (207 bp)   XM_001154194.1 2907 .. 3113 (207 bp)     Genomic (2) CM000325.1 61023151 .. 61023357 (207 bp)   AC196860.2 168107 .. 168313 (207 bp)     Whole Genome Shotgun sequences (2) AADA01131254.1 3119 .. 3325 (207 bp)   AACZ02125028.1 2881 .. 3087 (207 bp)        Rattus norvegicus   Polymorphism info:   Electronic PCR results ESTs (1) BE102509.1 167 .. 373 (207 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement