ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:12613 Links
D14S1010
Homo sapiens chromosome 14, locus PPP1R13B, polymorphic
Pan troglodytes chromosome 14, locus PPP1R13B

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:AGATTCTGGACTTGCCAAC
Reverse primer:GTAGTAGTCAGGGCTTCCTAGAG
PCR product size:140-156 (bp), Homo sapiens
GenBank Accession:Z53135

   Homo sapiens
Name: D14S1010
Also known as: AFMb025xa9 GDB:609456 HSB025XA9 SHGC-20890
Polymorphism info: on genetic map

Cross References Help
Gene GeneID:23368
 Symbol:PPP1R13B
 Description:protein phosphatase 1, regulatory (inhibitor) subunit 13B
 Position:14q32.33

Mapping InformationHelp
D14S1010 Sequence Map: Chr 14 Map Viewer
  Position: 103284102-103284255 (bp)
 
D14S1010 Sequence Map: Chr 14|Celera Map Viewer
  Position: 84268606-84268753 (bp)
 
D14S1010 Sequence Map: Chr 14|HuRef Map Viewer
  Position: 84392660-84392807 (bp)
 
AFMb025xa9 Genethon Map: Chr 14 Map Viewer
  Position: 124.70 (cM)
 
AFMb025xa9 Marshfield Map: Chr 14 Map Viewer
  Position: 134.30 (cM)
 
AFMb025xa9 NCBI RH Map: Chr 14 Map Viewer
  Position: 1126 (cR)
  Lod score: 1.54
 
SHGC-20890 TNG Map: Chr 14 Map Viewer
  Position: 43187 (cR50000)
  Lod score: 13.9
  Reference Interval: 119
 
SHGC-20890 Stanford-G3 Map: Chr 14 Map Viewer
  Position: 3892 (cR10000)
  Lod score: F
  Reference Interval: 79
 
AFMb025xa9 GeneMap99-G3 Map: Chr 14 Map Viewer
  Position: 4441 (cR10000)
  Lod score: F
  Reference Interval: D14S65-qTEL

Electronic PCR results Help
Genomic (5 of 9)[Show All Hits]
Z53135.1 47 .. 198 (152 bp)  
AL049840.8 98640 .. 98793 (154 bp)  
AL954800.2 84134390 .. 84134543 (154 bp)  
CH003461.1 83969952 .. 83970099 (148 bp)  
CH003509.1 85970585 .. 85970732 (148 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01141314.1 31766 .. 31913 (148 bp)  
AADC01118601.1 825899 .. 826046 (148 bp)  
AADB02016115.1 2875482 .. 2875629 (148 bp)  
ABBA01048412.1 6584 .. 6731 (148 bp)  
 

   Pan troglodytes
Name: D14S1010
Polymorphism info:  

Cross References Help
Gene GeneID:453193
 Symbol:PPP1R13B
 Description:protein phosphatase 1, regulatory (inhibitor) subunit 13B
 Position: 

Mapping InformationHelp
D14S1010 Sequence Map: Chr 14 Map Viewer
  Position: 104241464-104241599 (bp)

Electronic PCR results Help
Genomic (1)
CM000328.1 104241464 .. 104241599 (136 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC193253.3 143794 .. 143929 (136 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01123646.1 25155 .. 25290 (136 bp)  
AACZ02152107.1 25166 .. 25301 (136 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement