Handout     NAR 2006 Paper     NAR 2002 Paper     FAQ     MIAME     Email GEO  
   NCBI > GEO > Accession Display Not logged in | Login
GEO help: Mouse over screen elements for information.
Scope:    Format:    Amount:   GEO accession:    Go
Platform GPL5914 Query DataSets for GPL5914
Status Public on Oct 28, 2008
Title Chlamydomonas reinhardtii Version_2 Microarray
Technology type spotted oligonucleotide
Distribution non-commercial
Organism(s) Chlamydomonas reinhardtii
Manufacturer Stanford Functional Genomics Facility
Manufacture protocol Reference
Eberhard et al. (2002) Generation of an oligonucleotide array for analysis of gene expression in Chlamydomonas reinhardtii. Curr Genet (2006) 49: 106–124
Support glass
Coating unknown
 
 
Contributor(s) Nguyen AV, Rupprecht J, Thomas-Hall S, Hankamer B, Kruse O, Schenk PM
Citation(s)
Submission date Sep 20, 2007
Contact name Anh Vu Nguyen
E-mail(s) anh-vu.nguyen@uni-bielefeld.de
Phone 49 0521 106 5640
Organization name Bielefeld University
Department Cell and Molecular Biology
Lab Algae Biotech
Street address Universitaetsstr. 25
City Bielefeld
State/province NRW
ZIP/Postal code 33651
Country Germany
 
Samples (9) GSM231078, GSM231079, GSM231080, GSM231081, GSM231082, GSM231083 
Series (1)
GSE9165 The Transcriptome of Photo-Biological Hydrogen Production in the Green Alga Chlamydomonas reinhardtii

Data table header descriptions
ID
gal_file_ID Main ID used to present data corresponding to the ID in the original gal file
EMBL Accession or contig number
Gene Model Gene model
BLAST URL Blast URL
UserAnno Annotation
AutoAnno Annotation
Block Block
Row Row
Column Column
SEQUENCE oligonucleotide sequence
SPOT_ID

Data table
ID gal_file_ID EMBL Gene Model BLAST URL UserAnno AutoAnno Block Row Column SEQUENCE SPOT_ID
1 73.A EMBL 92.13.3.11 embl|X52304|CRPERAS nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_92:377218-377289 Periplasmic arylsulfatse 2 (+) arylsulfatase 2 precursor [Chlamydomonas reinhardtii] [Chlamydomonas reinhardtii], 57.6% id 1 1 1 ACGTTTCGATGTAATGGGTGTTTCCACGGAAGTTACAGGCAAGGTGCGTACATAACCCGGGATGCGATGA
2 85.A EMBL 42.8.2.11 embl|AF305613|AF305613 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_42:357951-358020 glutamyl-tRNA reductase precursor (GluTR) (HEMA) (HMA) (+) glutamyl-tRNA reductase precursor [Chlamydomonas reinhardtii] [Chlamydomonas reinhardtii], 100.0% id 1 1 2 AACGAAAGGGACTGGAGTGAGTCTCGCGCGGTGTGCTGTGAGTGCGCCTCAATTTAGCATTTTCTTTTCC
3 169.A EMBL 16.11.3.11 embl|AF498290|AF498290 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_16:642143-642074 3'-phosphoadenylsulfate reductase, APS reductase; not a PAPS reductase, based on presence of motifs described in PMID: 12072441 (-) 5'-adenylylsulfate reductase [Chlamydomonas reinhardtii] [Chlamydomonas reinhardtii], 100.0% id 1 1 3 GGATGTCGGCATGGAGGGTTGGCAAAATAGCGCTGGTAGAATAATTTCTCAGCTGCGATTCGGGACTCGA
4 181.A EMBL 710.1.1.5 AF129458.1 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_38:675352-675283 (+) OSJNBa0067K08.27 [Oryza sativa (japonica cultivar-group)] [no tax name], 23.2% id 1 1 4 CCTGCGGACTGAGGTTTCCTCCTTTTATATTCTACAGCATGAAGCACGCATTCGCACAGGCCGTGACGCG
5 265.A EMBL embl|AY032930|AY032930 Chlamydomonas reinhardtii strain CC-621 probe 6 protein mRNA, complete cds. nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_157:198516-198567 SppA, protease IV, signal peptide peptidase, serine endopeptidase (ClpP clan), probe 6 (+) probe 6 protein [Chlamydomonas reinhardtii] [Chlamydomonas reinhardtii], 100.0% id 1 1 5 ACCAGGAGTGGTTAACGGCCTCATGCATGCAGGAGTGTGCGACAGGTACCGTATCTAACTGTCATGTCCG
6 277.A EMBL 35.6.4.11 embl|AF411119|AF411119 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_35:692507-692438 subunit 6 of the mitochondrial F(0)F(1)-ATP synthase (-) ATP synthase F1F0 subunit 6 [Chlamydomonas reinhardtii] [Chlamydomonas reinhardtii], 100.0% id 1 1 6 CTCCCAGGAGTATCGAGCACACGGGTGGCCCGAAAGTAGGTTTCAATAGCTTTGCGTGAGGGTTTTGTGG
7 361.A EMBL 68.64.2.11 embl|U19876|CR19876 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_68:24399-24465 Delta-aminolevulinic acid dehydratase, ..chloroplast precursor (Porphobilinogen ..synthase) (ALADH) (HEM2) (+) Delta-aminolevulinic acid dehydratase, chloroplast precursor (Porphobilinogen synthase) (ALADH) [Chlamydomonas reinhardtii], 100.0% id 1 1 7 GCAAGACACGCGCGGCTGGCAAATCACAGGGTGTGCCCTCCCAAAGATTGTTAGCTTCAAAGCTTTG
8 373.A EMBL embl|AF481828|AF481828 Chlamydomonas reinhardtii chloroplast sulfate transport system permease (SulP) mRNA, complete cds; nuclear gene for chloroplast product. nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_10:544241-544172 related to CysT (-) chloroplast sulfate transport system permease [Chlamydomonas reinhardtii] [Chlamydomonas reinhardtii], 73.7% id 1 1 8 GGGTGGGACTTTGGGTGGGTGGGAGTGGGTGCTACGTATTAGGATATGGGAGGTGGTATGCAGTTGAAGG
9 457.A EMBL AY442316.1 YPTC4 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_8:808219-808269 Expressed Protein. Similar to the RabB/Rab2 type GTPase, involved in vesicle trafficking in the ER-Golgi system...Identical to YPTC4 [gi|2500074|sp|Q39570|YPT4_CHLRE]. (+) GTP-binding protein YPTC4 [Chlamydomonas reinhardtii], 100.0% id 1 1 9 CTCCACACAATGTTCGTGAGTATGCAAACAGTGAAAGTGGGAGTGCAGGCGGGTCAGCGGCGAGTGCGT
10 469.A EMBL 161.2.2.11 AB122115.1 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_161:75181-75112 light-harvesting protein of photosystem I (-) chlorophyll a/b-binding protein type III precursor - tomato [Lycopersicon esculentum], 77.7% id 1 1 10 CTCGTACAACGGCTACTGGGCTGACCCCTACACCATCTTCTTCGTGGAGATCGTGGCTATGCAGTTCGCT
11 553.C contig 63.17.2.11 C_630090 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_63:529258-529189 (-) 1500031L02Rik; RIKEN cDNA 1500031L02 gene [Mus musculus], 46.6% id 1 1 11 GCTGCCGTGCTAACCCAGGTGTGGAACAGGGCGCTTCGCTTGATGTAATTGTGTTTACTGAATCCTTTCT
12 565.C contig 74.24.2.51 C_740069 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_74:475038-474973 (-) Hypothetical protein yqjK [Bacillus subtilis], 69.1% id 1 1 12 GGAGCAGCAGCACTGGCTCTAGGTTGCAACAGGCTGCGTCTGTGTCATCCTCGTCGTCGGCGGCGG
13 649.C contig 7.157.1.0 C_70021 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_7:1212363-1212425 (+) (Q9LT41) RCD1 [Arabidopsis thaliana], 85.3% id 1 1 13 CTGAAGCACAGCCACTAGGACACATCGGGCATGGCTGGACGCCGATGCGTGTGATCCATGTGT
14 661.C contig 3.129.1.5 C_30069 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_3:228109-228178 Histone acetyltransferase type b catalytic subunit. Histone acetyltransferases (GNAT/MYST superfamily) (+) (Q9FJT8) Histone acetyltransferase HAT B [Arabidopsis thaliana], 67.2% id 1 1 14 AGCACTCCCGCTGTTGCTAAGGAAATCGTTAGCAGTCCTAGAGACAAAGCGTTAAGACGACCACCCGTGT
15 745.C contig 46.17.2.51 nil NO HITS 1 1 15 TTGCCGGACAGCTTTCGCCTTTCCTTAAAACAGCGTGCTTTTGAGAACTAAGAACAGCAGCAATAAGCGT
16 757.C contig 97.32.1.5 C_970047 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_97:173727-173667 (-) ITPR3; inositol 1,4,5-triphosphate receptor, type 3 [SP:IP3T_HUMAN] [Homo sapiens], 95.7% id 1 1 16 GGGCTCCTCAAGGTTGCTGGCAAGCCGATTGACATGGACGACATCAACGAGCCGCCGCAGGA
17 841.C contig 150.19.1.0 nil http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_150:168124-168193 1 1 17 TGCTTCTAACCCGATTGTCTCGTTCTCTTACGGACCAGTGCACGCGTCCATCTCCATGTGTGGCCTAAGA
18 853.C contig 11.83.1.5 C_110169 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_11:413684-413617 (-) Tax_Id=9606 Splice isoform 1 of Q15149 Plectin 1 [Homo sapiens], 21.7% id 1 1 18 CGCGGGAGTCTGACCTGCGTGCCACGCGTGACCGCACCGTCGAGGAGCTTAAGTCTGCGCATCAGGAG
19 937.C contig 9.76.2.11 C_90088 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_9:863391-863460 (+) putative carbamoyl phosphate synthase small subunit [Nicotiana tabacum] [Nicotiana tabacum], 81.2% id 1 1 19 CGGGAGCGCCGAAGAGGATGGGTCTCTACGATCTGCACTGTATATGGCTGAGAATGCTGGCCCTAATTCC
20 949.C contig 11.21.2.51 C_110222 http://genome.jgi-psf.org/cgi-bin/browserNewSession?db=chlre2&position=scaffold_11:95836-95792 (-) LYSYL-TRNA SYNTHETASE (LYSINE--TRNA LIGASE) (LYSRS) [Cricetulus longicaudatus], 77.7% id 1 1 20 CAAGGGCAGCTACAAGATCGCCTACCACCCCGACGGCCCCGAGAA

Total number of rows: 21120

Table truncated, full table size 5569 Kbytes.




Download family Format
SOFT formatted family file(s) SOFT
MINiML formatted family file(s) MINiML

Supplementary file Size Download File type/resource
GPL5914_gal.txt.gz 1.5 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Section 508 |
NCBI Home NCBI Search NCBI SiteMap