PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:54757 Links STS-AA010197 Canis familiaris chromosome 29, locus ZFHX4 Equus caballus chromosome 9, locus ZFHX4 Homo sapiens chromosome 8, locus ZFHX4 Macaca mulatta chromosome 8, locus LOC701524 Pan troglodytes chromosome 8, locus LOC464241 Found by e-PCR in sequences from Canis familiaris, Homo sapiens, Pan troglodytes and Sus scrofa. Primer Information Forward primer: GGGTGTTTTTCGGGTTTGG Reverse primer: CAGCTACTTCGTCTCCTGCC PCR product size: 226 (bp), Homo sapiens    Canis familiaris Name: STS-AA010197 Polymorphism info:   Cross References Gene GeneID: 487006   Symbol: ZFHX4   Description: zinc finger homeobox 4   Position:   Mapping Information STS-AA010197 Sequence Map: Chr 29 Map Viewer   Position: 27844195-27844420 (bp) Electronic PCR results RefSeq mRNA (1) XM_848173.1 9338 .. 9563 (226 bp)     Genomic (1) CM000029.2 27844195 .. 27844420 (226 bp)     Whole Genome Shotgun sequences (1) AAEX02028025.1 28063 .. 28288 (226 bp)        Equus caballus Name: STS-AA010197 Polymorphism info:   Cross References Gene GeneID: 100050705   Symbol: ZFHX4   Description: zinc finger homeobox 4   Position:   Mapping Information STS-AA010197 Sequence Map: Chr 9 Map Viewer   Position: 10206221-10206446 (bp)    Homo sapiens Name: STS-AA010197 Also known as: sts-AA010197 Polymorphism info:   Cross References Gene GeneID: 79776   Symbol: ZFHX4   Description: zinc finger homeobox 4   Position: 8q21.11 UniGene Hs.458973 Zinc finger homeobox 4 Mapping Information STS-AA010197 Sequence Map: Chr 8|HuRef Map Viewer   Position: 73261470-73261695 (bp)   STS-AA010197 Sequence Map: Chr 8|Celera Map Viewer   Position: 73768749-73768974 (bp)   STS-AA010197 Sequence Map: Chr 8 Map Viewer   Position: 77937927-77938152 (bp)   sts-AA010197 NCBI RH Map: Chr 8 Map Viewer   Position: 852.9 (cR)   Lod score: 1.46   sts-AA010197 GeneMap99-GB4 Map: Chr 8 Map Viewer   Position: 393.42 (cR3000)   Lod score: 3.00   Reference Interval: D8S526-D8S275 Electronic PCR results RefSeq mRNA (1) NM_024721.3 9674 .. 9899 (226 bp)     mRNA (5 of 7)[Show All Hits] AY260762.1 9319 .. 9544 (226 bp)   BX649074.1 2990 .. 3215 (226 bp)   BC047745.2 95 .. 320 (226 bp)   AK131399.1 2762 .. 2987 (226 bp)   AK131462.1 1894 .. 2119 (226 bp)     Genomic (5 of 9)[Show All Hits] AC023200.6 91230 .. 91455 (226 bp)   AC090711.3 121238 .. 121463 (226 bp)   CH003455.1 73543299 .. 73543524 (226 bp)   CH003503.1 83346896 .. 83347121 (226 bp)   DQ037864.1 9344 .. 9569 (226 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC129985.1 120880 .. 121105 (226 bp)     ESTs (5) AA010197.1 2 .. 227 (226 bp)   BQ932671.1 118 .. 343 (226 bp)   CK000650.1 315 .. 540 (226 bp)   CN482897.1 67 .. 292 (226 bp)   BP330210.1 59 .. 285 (227 bp)     Whole Genome Shotgun sequences (4) AADD01092807.1 10023 .. 10248 (226 bp)   AADC01077452.1 68117 .. 68342 (226 bp)   AADB02011729.1 1051126 .. 1051351 (226 bp)   ABBA01041998.1 9662 .. 9887 (226 bp)        Macaca mulatta Name: STS-AA010197 Polymorphism info:   Cross References Gene GeneID: 701524   Symbol: LOC701524   Description: similar to zinc finger homeodomain 4   Position:   Mapping Information STS-AA010197 Sequence Map: Chr 8 Map Viewer   Position: 79335668-79335893 (bp)    Pan troglodytes Name: STS-AA010197 Polymorphism info:   Cross References Gene GeneID: 464241   Symbol: LOC464241   Description: similar to zinc-finger homeodomain protein 4   Position:   Mapping Information STS-AA010197 Sequence Map: Chr 8 Map Viewer   Position: 75374873-75375095 (bp) Electronic PCR results RefSeq mRNA (1) XR_024967.1 9512 .. 9734 (223 bp)     Genomic (1) CM000322.2 75374873 .. 75375095 (223 bp)     Whole Genome Shotgun sequences (2) AADA01070440.1 11925 .. 12147 (223 bp)   AACZ02096027.1 36599 .. 36821 (223 bp)        Sus scrofa   Polymorphism info:   Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (1) CU179688.2 37191 .. 37419 (229 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement