National Cancer Institute U.S. National Institutes of Health www.cancer.gov
NCI Header
mAdb Home Page | mAdb Gateway | Upload Status
Reference Info | Program Downloads | GeneCards
mAdb Feature Report

 
Affymetrix Target 201670_s_at    NetAffx (NetAffx login required)
Target Sequence 397 bps ggagaacttgtctacaaccagggattgattttaaagatgtctttttttattttacttttttttaagcacc
aaattttgttgttttttttttctcccctccccacagatcccatctcaaatcattctgttaaccaccattc
caacaggtcgaggagagcttaaacaccttcttcctctggccttgtttctcttttattttttattttttcg
catcagtattaatgtttttgcatactttgcatctttattcaaaagtgtaaactttctttgtcaatctatg
gacatgcccatatatgaaggagatgggtgggtcaaaaagggatatcaaatgaagtgataggggtcacaat
ggggaaattgaagtggtgcataacattgccaaaatagtgtgccacta
BLAST Results NT   RefSeq   UG-All   Genome
Assigned to Refseq  NM_002356   UCSC's GenomeViewer 

mAdb Annotation SourceRefSeq record based on mAdb verified sequence match
mAdb Assigned RefSeq NM_002356 based on a BLAST alignment match length of 219 with 0 mismatches and 0 gaps
mAdb RefSeq Protein NP_002347   NCBI's BLink
mAdb Mapping
Mapped   Str   Chr  Chr:Start-Stop BP    Cytoband    Genome Assembly 
Affymetrix Target   +   6    chr6:114288526-114288924   6q22.1    NCBI B36 (UCSC hg18) 
NM_002356  +   6    chr6:114285219-114291345   6q22.1    NCBI B36 (UCSC hg18) 
Hs.519909     6    chr6:114285028-114291538   6q22.1    NCBI B36 (UCSC hg18) 
CytoGenetic Map6q22.2
Entrez GeneID 4082
Gene SymbolMARCKS  GeneCards  
UniGene ClusterTP  Hs.519909    CGAP's Gene    Stanford's S.O.U.R.C.E.
RefSeqs in Cluster NM_002356
Titlemyristoylated alanine-rich protein kinase C substrate (MARCKS), mRNA.
Gene Summary
The protein encoded by this gene is a substrate for protein kinase C. It is localized to the plasma membrane and is an actin filament crosslinking protein. Phosphorylation by protein kinase C or binding to calcium-calmodulin inhibits its association withactin and with the plasma membrane, leading to its presence in the cytoplasm. The protein is thought to be involved in cell motility, phagocytosis, membrane trafficking and mitogenesis. [provided by RefSeq]
BioCarta Pathways   Effects of calcineurin in Keratinocyte Differentiation
Gene Ontology
GO TM Annotations  Evidence   Source    Pub 
Function
actin filament binding   TAS   GOA   PM
calmodulin binding   TAS   GOA   PM
Component
actin cytoskeleton   TAS   GOA   PM
cell cortex   IEA   GOA  
centrosome   IEA   GOA  
cytoplasm   IEA   GOA  
germinal vesicle   IEA   GOA  
membrane   IEA   GOA  

 

NIH BioInformatics support provided by BIMAS/CBEL/CIT.
We can be contacted by email.