PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:19692 Links STS-N34870 Homo sapiens chromosome 11, locus RNF141 Macaca mulatta chromosome 14, locus LOC706002 Pan troglodytes chromosome 11, locus RNF141 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: ATGGAAAACATATTAGTGATAGCTC Reverse primer: TAACCTTTGTGCTTTTTTGTAATTT PCR product size: 148 (bp), Homo sapiens    Homo sapiens Name: STS-N34870 Also known as: sts-N34870 Polymorphism info:   Cross References Gene GeneID: 50862   Symbol: RNF141   Description: ring finger protein 141   Position: 11p15.4 UniGene Hs.659251 Transcribed locus Mapping Information STS-N34870 Sequence Map: Chr 11|HuRef Map Viewer   Position: 10215386-10215533 (bp)   STS-N34870 Sequence Map: Chr 11 Map Viewer   Position: 10499520-10499667 (bp)   STS-N34870 Sequence Map: Chr 11|Celera Map Viewer   Position: 10664457-10664604 (bp)   sts-N34870 NCBI RH Map: Chr 11 Map Viewer   Position: 56.3 (cR)   Lod score: 2.00   sts-N34870 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 50.28 (cR3000)   Lod score: 0.90   Reference Interval: D11S4194-D11S926 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC021914.7 31938 .. 32085 (148 bp)   CH003458.1 10461996 .. 10462143 (148 bp)   CH003506.1 9922257 .. 9922404 (148 bp)   CH471064.2 6164781 .. 6164928 (148 bp)   CM000262.1 10664457 .. 10664604 (148 bp)     ESTs (1) N34870.1 108 .. 255 (148 bp)     Whole Genome Shotgun sequences (4) AADD01112994.1 11126 .. 11273 (148 bp)   AADC01096058.1 11263 .. 11410 (148 bp)   AADB02013641.1 241691 .. 241838 (148 bp)   ABBA01061157.1 63908 .. 64055 (148 bp)        Macaca mulatta Name: STS-N34870 Polymorphism info:   Cross References Gene GeneID: 706002   Symbol: LOC706002   Description: similar to ring finger protein 141   Position:   Mapping Information STS-N34870 Sequence Map: Chr 14 Map Viewer   Position: 61431710-61431857 (bp)    Pan troglodytes Name: STS-N34870 Polymorphism info:   Cross References Gene GeneID: 451023   Symbol: RNF141   Description: ring finger protein 141   Position:   Mapping Information STS-N34870 Sequence Map: Chr 11 Map Viewer   Position: 10465322-10465469 (bp) Electronic PCR results Genomic (1) CM000325.1 10465322 .. 10465469 (148 bp)     Whole Genome Shotgun sequences (2) AADA01077941.1 3551 .. 3698 (148 bp)   AACZ02122556.1 3551 .. 3698 (148 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement