PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:43141 Links D4S2816 Homo sapiens chromosome 4 Pan troglodytes chromosome 4 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GACAGGTCTTTATTAGGGCACG Reverse primer: GATACTTGCTTGCCAATTAGGG PCR product size: 100-101 (bp), Homo sapiens GenBank Accession: G05713 T47579    Homo sapiens Name: D4S2816 Also known as: EST99392 GDB:588502 SHGC-25021 WI-8606 Polymorphism info:   Cross References UniGene Hs.593220 Transcribed locus Mapping Information D4S2816 Sequence Map: Chr 4|HuRef Map Viewer   Position: 69935436-69935536 (bp)   D4S2816 Sequence Map: Chr 4|Celera Map Viewer   Position: 71485220-71485320 (bp)   D4S2816 Sequence Map: Chr 4 Map Viewer   Position: 74347995-74348095 (bp)   SHGC-25021 NCBI RH Map: Chr 4 Map Viewer   Position: 861.2 (cR)   Lod score: 2.18   SHGC-25021 Stanford-G3 Map: Chr 4 Map Viewer   Position: 4072 (cR10000)   Lod score: F   Reference Interval: 101   SHGC-25021 GeneMap99-G3 Map: Chr 4 Map Viewer   Position: 4056 (cR10000)   Lod score: F   Reference Interval: D4S392-D4S2947   WI-8606 Whitehead-YAC Map: Chr 4 Map Viewer   Reference Interval: WC4.3 Electronic PCR results Genomic (5 of 8)[Show All Hits] G05713.1 216 .. 316 (101 bp)   G33715.1 216 .. 316 (101 bp)   AC053527.8 160514 .. 160614 (101 bp)   CH471057.1 21310194 .. 21310294 (101 bp)   CM000255.1 71485220 .. 71485320 (101 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AP002857.1 60343 .. 60443 (101 bp)     ESTs (4) T47578.1 78 .. 178 (101 bp)   T47579.1 216 .. 316 (101 bp)   AA233553.1 213 .. 313 (101 bp)   AA661990.1 225 .. 325 (101 bp)     Whole Genome Shotgun sequences (2) AADB02006950.1 130207 .. 130307 (101 bp)   ABBA01022987.1 12805 .. 12905 (101 bp)        Pan troglodytes Name: D4S2816 Polymorphism info:   Mapping Information D4S2816 Sequence Map: Chr 4 Map Viewer   Position: 57247221-57247321 (bp) Electronic PCR results Genomic (1) CM000318.1 57247221 .. 57247321 (101 bp)     Whole Genome Shotgun sequences (2) AADA01308008.1 2087 .. 2187 (101 bp)   AACZ02048833.1 4329 .. 4429 (101 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement