PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:61809 Links STS-M86407 Homo sapiens chromosome 11, loci ACTN3 and CTSF Macaca mulatta chromosome 14, loci LOC713811 and LOC713743 Pan troglodytes chromosome 11, loci LOC746579 and LOC466680 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TACTGCATCCGCCGTATGGT Reverse primer: ACCTCAGTGGTTGGGGTCA PCR product size: 121 (bp), Homo sapiens    Homo sapiens Name: STS-M86407 Also known as: sts-M86407 Polymorphism info:   Cross References Gene GeneID: 8722   Symbol: CTSF   Description: cathepsin F   Position: 11q13 Gene GeneID: 89   Symbol: ACTN3   Description: actinin, alpha 3   Position: 11q13.1 UniGene Hs.624349 Transcribed locus, strongly similar to NP_038484.1 actinin alpha 3 [Mus musc...   Hs.654432 Actinin, alpha 3 Mapping Information STS-M86407 Sequence Map: Chr 11|HuRef Map Viewer   Position: 62658474-62658594 (bp)   STS-M86407 Sequence Map: Chr 11|Celera Map Viewer   Position: 63650839-63650959 (bp)   STS-M86407 Sequence Map: Chr 11 Map Viewer   Position: 66087136-66087256 (bp)   sts-M86407 NCBI RH Map: Chr 11 Map Viewer   Position: 578.5 (cR)   Lod score: 2.91   sts-M86407 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 249.75 (cR3000)   Lod score: 3.00   Reference Interval: D11S913-D11S916 Electronic PCR results RefSeq mRNA (1) NM_001104.1 2620 .. 2740 (121 bp)     mRNA (5 of 6)[Show All Hits] M86407.1 2620 .. 2740 (121 bp)   AK125851.1 3233 .. 3353 (121 bp)   BC099648.1 1368 .. 1488 (121 bp)   BC099647.3 2620 .. 2740 (121 bp)   BC099649.3 2620 .. 2740 (121 bp)     Genomic (5 of 7)[Show All Hits] AP002748.4 136251 .. 136371 (121 bp)   CH003458.1 64833658 .. 64833778 (121 bp)   CH003506.1 64695893 .. 64696013 (121 bp)   CH471076.1 11998915 .. 11999035 (121 bp)   CM000262.1 63650839 .. 63650959 (121 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AP001100.3 81233 .. 81353 (121 bp)   AP000481.3 60051 .. 60171 (121 bp)   AC019220.3 171168 .. 171288 (121 bp)     ESTs (5 of 14)[Show All Hits] T29827.1 48 .. 168 (121 bp)   F17757.1 205 .. 325 (121 bp)   AA196000.1 166 .. 286 (121 bp)   F21130.1 14 .. 134 (121 bp)   AI224547.1 176 .. 296 (121 bp)     Whole Genome Shotgun sequences (4) AADD01116522.1 3554 .. 3674 (121 bp)   AADC01099333.1 91402 .. 91522 (121 bp)   AADB02014136.1 41456 .. 41576 (121 bp)   ABBA01024074.1 10067 .. 10187 (121 bp)        Macaca mulatta Name: STS-M86407 Polymorphism info:   Cross References Gene GeneID: 713743   Symbol: LOC713743   Description: similar to Cathepsin F precursor (CATSF)   Position:   Gene GeneID: 713811   Symbol: LOC713811   Description: similar to skeletal muscle specific actinin, alpha 3   Position:   UniGene Mmu.15808 Similar to skeletal muscle specific actinin, alpha 3 Mapping Information STS-M86407 Sequence Map: Chr 14 Map Viewer   Position: 7894239-7894359 (bp)    Pan troglodytes Name: STS-M86407 Polymorphism info:   Cross References Gene GeneID: 466680   Symbol: LOC466680   Description: similar to alpha-actinin   Position:   Gene GeneID: 746579   Symbol: LOC746579   Description: similar to cathepsin F precursor   Position:   Mapping Information STS-M86407 Sequence Map: Chr 11 Map Viewer   Position: 65029778-65029898 (bp) Electronic PCR results RefSeq mRNA (1) XR_025196.1 2684 .. 2804 (121 bp)     Genomic (1) CM000325.1 65029778 .. 65029898 (121 bp)     Whole Genome Shotgun sequences (2) AADA01044039.1 710 .. 830 (121 bp)   AACZ02125498.1 3642 .. 3762 (121 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement