PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:4970 Links G20357 Homo sapiens chromosome 18, locus TTC39C Pan troglodytes chromosome 18 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AAGTATCATCACTTCAGGTATC Reverse primer: CTGAACTTCTTTAAAGACAATC PCR product size: 137 (bp), Homo sapiens GenBank Accession: G20357    Homo sapiens Name: G20357 Also known as: A005N33 Polymorphism info:   Cross References Gene GeneID: 125488   Symbol: TTC39C   Description: tetratricopeptide repeat domain 39C   Position: 18q11.2 UniGene Hs.128576 Chromosome 18 open reading frame 17 Mapping Information G20357 Sequence Map: Chr 18|Celera Map Viewer   Position: 18520027-18520163 (bp)   G20357 Sequence Map: Chr 18|HuRef Map Viewer   Position: 18559777-18559913 (bp)   G20357 Sequence Map: Chr 18 Map Viewer   Position: 19957718-19957854 (bp) Electronic PCR results Genomic (5 of 8)[Show All Hits] G20357.1 1 .. 137 (137 bp)   AC090772.9 132362 .. 132498 (137 bp)   CH003465.1 17436529 .. 17436665 (137 bp)   CH003513.1 20895766 .. 20895902 (137 bp)   CH471088.1 3188432 .. 3188568 (137 bp)     Working Draft phase 1 (from GenBank HTGS division) (5) AC016127.3 46234 .. 46370 (137 bp)   AP001164.2 119444 .. 119580 (137 bp)   AP001177.3 99564 .. 99700 (137 bp)   AC090332.5 53788 .. 53924 (137 bp)   AC023989.7 115277 .. 115413 (137 bp)     ESTs (5 of 8)[Show All Hits] T75185.1 73 .. 209 (137 bp)   T77004.1 131 .. 267 (137 bp)   F12949.1 161 .. 297 (137 bp)   F13040.1 161 .. 297 (137 bp)   AV646121.1 56 .. 192 (137 bp)     Whole Genome Shotgun sequences (4) AADD01158126.1 11802 .. 11938 (137 bp)   AADC01133732.1 44362 .. 44498 (137 bp)   AADB02019412.1 423027 .. 423163 (137 bp)   ABBA01022620.1 4193 .. 4329 (137 bp)        Pan troglodytes Name: G20357 Polymorphism info:   Mapping Information G20357 Sequence Map: Chr 18 Map Viewer   Position: 19938607-19938743 (bp) Electronic PCR results Genomic (1) CM000332.1 19938607 .. 19938743 (137 bp)     Whole Genome Shotgun sequences (2) AADA01049247.1 3898 .. 4034 (137 bp)   AACZ02176610.1 92372 .. 92508 (137 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement