PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:25539 Links D20S563E Homo sapiens chromosome 20, locus EFCAB8 Pan troglodytes chromosome 20, locus EFCAB8 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAGACAGTGAAAGGAGTTACAG Reverse primer: CAGAAGGCAGAGGAGCAG PCR product size: 187 (bp), Homo sapiens    Homo sapiens Name: D20S563E Also known as: Cda15a12 GDB:441216 stSG3040 Polymorphism info:   Cross References Gene GeneID: 388795   Symbol: EFCAB8   Description: EF-hand calcium binding domain 8   Position: 20q11.21 UniGene Hs.145500 Transcribed locus   Hs.702363 Transcribed locus Mapping Information D20S563E Sequence Map: Chr 20|Celera Map Viewer   Position: 28200200-28200386 (bp)   D20S563E Sequence Map: Chr 20|HuRef Map Viewer   Position: 28233565-28233751 (bp)   D20S563E Sequence Map: Chr 20 Map Viewer   Position: 30909988-30910174 (bp)   stSG3040 NCBI RH Map: Chr 20 Map Viewer   Position: 286.9 (cR)   Lod score: 2.23   stSG3040 GeneMap99-GB4 Map: Chr 20 Map Viewer   Position: 190.92 (cR3000)   Lod score: 1.05   Reference Interval: D20S182-D20S106 Electronic PCR results Genomic (5 of 7)[Show All Hits] AL035071.17 118427 .. 118613 (187 bp)   CH003467.1 28153091 .. 28153277 (187 bp)   CH003515.1 29109596 .. 29109782 (187 bp)   CH471077.2 1703309 .. 1703495 (187 bp)   CM000271.1 28200200 .. 28200386 (187 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AL354832.10 89161 .. 89347 (187 bp)     ESTs (5 of 32)[Show All Hits] Z39237.1 44 .. 230 (187 bp)   H72687.1 24 .. 210 (187 bp)   H91742.1 45 .. 233 (189 bp)   AA148783.1 38 .. 224 (187 bp)   AA193594.1 55 .. 241 (187 bp)     Whole Genome Shotgun sequences (4) AADD01168867.1 2625 .. 2811 (187 bp)   AADC01141621.1 117318 .. 117504 (187 bp)   AADB02020270.1 845379 .. 845565 (187 bp)   ABBA01019251.1 5316 .. 5502 (187 bp)        Pan troglodytes Name: D20S563E Polymorphism info:   Cross References Gene GeneID: 458175   Symbol: EFCAB8   Description: EF-hand calcium binding domain 8   Position:   Mapping Information D20S563E Sequence Map: Chr 20 Map Viewer   Position: 29825793-29825979 (bp) Electronic PCR results Genomic (1) CM000334.2 29825793 .. 29825979 (187 bp)     ESTs (1) CB296439.1 73 .. 259 (187 bp)     Whole Genome Shotgun sequences (2) AADA01167630.1 31382 .. 31568 (187 bp)   AACZ02190289.1 5151 .. 5337 (187 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement