PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:67029 Links RH16293 Homo sapiens chromosome 18, locus SLC14A1 Pan troglodytes chromosome 18, locus SLC14A1 Found by e-PCR in sequences from Homo sapiens, Mus musculus and Pan troglodytes. Primer Information Forward primer: TCCTGAGTAGCTGCTGCAGA Reverse primer: AAGTCACGTTCAGGGACTGG PCR product size: 188 (bp), Homo sapiens    Homo sapiens Name: RH16293 Also known as: stSG8531 Polymorphism info:   Cross References Gene GeneID: 6563   Symbol: SLC14A1   Description: solute carrier family 14 (urea transporter), member 1 (Kidd blood group)   Position: 18q11-q12 UniGene Hs.101307 Solute carrier family 14 (urea transporter), member 1 (Kidd blood group) Mapping Information RH16293 Sequence Map: Chr 18|Celera Map Viewer   Position: 40139786-40139971 (bp)   RH16293 Sequence Map: Chr 18|HuRef Map Viewer   Position: 40188576-40188761 (bp)   RH16293 Sequence Map: Chr 18 Map Viewer   Position: 41585454-41585639 (bp)   stSG8531 NCBI RH Map: Chr 18 Map Viewer   Position: 560.4 (cR)   Lod score: 1.57   stSG8531 GeneMap99-GB4 Map: Chr 18 Map Viewer   Position: 332.68 (cR3000)   Lod score: 3.00   Reference Interval: D18S468-D18S460 Electronic PCR results mRNA (1) AF263545.1 262 .. 446 (185 bp)     Genomic (5 of 10)[Show All Hits] AC023421.7 156753 .. 156938 (186 bp)   AC087685.9 135672 .. 135857 (186 bp)   CH003465.1 39055088 .. 39055273 (186 bp)   CH003513.1 44586425 .. 44586610 (186 bp)   AY942197.1 29288 .. 29473 (186 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AP002384.1 79783 .. 79968 (186 bp)   AP001907.3 8890 .. 9075 (186 bp)   AC090759.2 77141 .. 77326 (186 bp)     ESTs (5 of 10)[Show All Hits] F00078.1 21 .. 206 (186 bp)   R98010.1 73 .. 258 (186 bp)   R98244.1 140 .. 326 (187 bp)   H70868.1 106 .. 293 (188 bp)   AA370993.1 96 .. 281 (186 bp)     Whole Genome Shotgun sequences (4) AADD01159450.1 12094 .. 12279 (186 bp)   AADC01134767.1 43740 .. 43925 (186 bp)   AADB02019604.1 43743 .. 43928 (186 bp)   ABBA01022335.1 40468 .. 40653 (186 bp)        Mus musculus   Polymorphism info:   Electronic PCR results Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC101470.1 49438 .. 49623 (186 bp)        Pan troglodytes Name: RH16293 Polymorphism info:   Cross References Gene GeneID: 455393   Symbol: SLC14A1   Description: solute carrier family 14 (urea transporter), member 1 (Kidd blood group)   Position:   Mapping Information RH16293 Sequence Map: Chr 18 Map Viewer   Position: 41963727-41963911 (bp) Electronic PCR results RefSeq mRNA (5 of 8)[Show All Hits] XM_512108.2 3046 .. 3230 (185 bp)   XM_001144325.1 3415 .. 3599 (185 bp)   XM_001144467.1 3067 .. 3251 (185 bp)   XM_001144549.1 2912 .. 3096 (185 bp)   XM_001144083.1 2740 .. 2924 (185 bp)     Genomic (1) CM000332.1 41963727 .. 41963911 (185 bp)     Whole Genome Shotgun sequences (2) AADA01233923.1 12205 .. 12389 (185 bp)   AACZ02177657.1 12206 .. 12390 (185 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement