PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:79583 Links SHGC-59824 Homo sapiens chromosome 4, locus GAB1 Pan troglodytes chromosome 4, locus GAB1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTGAGGATTGGGAAAATAAACC Reverse primer: CAGTTGAGGCATGACCCC PCR product size: 131 (bp), Homo sapiens    Homo sapiens Name: SHGC-59824 Also known as: stSG4342 Polymorphism info:   Cross References Gene GeneID: 2549   Symbol: GAB1   Description: GRB2-associated binding protein 1   Position: 4q31.21 UniGene Hs.80720 GRB2-associated binding protein 1 Mapping Information SHGC-59824 Sequence Map: Chr 4|HuRef Map Viewer   Position: 140121650-140121781 (bp)   SHGC-59824 Sequence Map: Chr 4|Celera Map Viewer   Position: 141721871-141722002 (bp)   SHGC-59824 Sequence Map: Chr 4 Map Viewer   Position: 144611313-144611444 (bp)   stSG4342 GeneMap99-GB4 Map: Chr 4 Map Viewer   Position: 621.62 (cR3000)   Lod score: 0.84   Reference Interval: D4S1604-D4S1586 Electronic PCR results mRNA (1) AK022142.1 2518 .. 2649 (132 bp)     Genomic (5 of 8)[Show All Hits] AC104685.2 80073 .. 80204 (132 bp)   CH003451.1 141259634 .. 141259765 (132 bp)   CH003499.1 146391381 .. 146391512 (132 bp)   DQ021880.1 134385 .. 134516 (132 bp)   CH471056.2 23979350 .. 23979481 (132 bp)     ESTs (5 of 25)[Show All Hits] T98154.1 141 .. 271 (131 bp)   R15908.1 154 .. 284 (131 bp)   N80653.1 104 .. 234 (131 bp)   W85766.1 136 .. 267 (132 bp)   AA583134.1 135 .. 266 (132 bp)     Whole Genome Shotgun sequences (4) AADD01051926.1 1832 .. 1963 (132 bp)   AADC01045502.1 1447 .. 1578 (132 bp)   AADB02007607.1 415753 .. 415884 (132 bp)   ABBA01070003.1 1967 .. 2098 (132 bp)        Pan troglodytes Name: SHGC-59824 Polymorphism info:   Cross References Gene GeneID: 461516   Symbol: GAB1   Description: GRB2-associated binding protein 1   Position:   Mapping Information SHGC-59824 Sequence Map: Chr 4 Map Viewer   Position: 147285455-147285587 (bp) Electronic PCR results RefSeq mRNA (1) XM_517458.2 3925 .. 4057 (133 bp)     Genomic (1) CM000318.1 147285455 .. 147285587 (133 bp)     Whole Genome Shotgun sequences (2) AADA01074959.1 13818 .. 13950 (133 bp)   AACZ02053105.1 1916 .. 2048 (133 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement