Back to main OxyR model comparison page
This is the first upgrade of the OxyR model, referred to as Model 2. It contains binding sites in the promoters of the following genes:
Below is the aligned listing and instruction file.
alist 6.25, aligned listing of book:
* 2000/08/15 13:10:29, 1999/05/04 14:41:13,
OxyR version = 2.16 of inst.oxyr 2000 June 27
piece names from:
* 2000/08/15 13:10:29, 1999/05/04 14:41:13,
OxyR version = 2.16 of inst.oxyr 2000 June 27
The alignment is by delila instructions
The book is from: -200 to 200
This alignment is from: -25 to 25
---------------- ++++++++++++++++
2222221111111111--------- +++++++++1111111111222222
543210987654321098765432101234567890123456789012345
................................................... bits
dsbG U00096 637851 + 1 tcgagtaaaaggcataacctatcactgtcataggtaagagcttagatcagg 29.5
U00096 637851 - 2 cctgatctaagctcttacctatgacagtgataggttatgccttttactcga 29.5
ahpC U00096 638089 + 3 aaggttgtaaggtaaaacttatcgatttgataatggaaacgcattagccga 22.6
U00096 638089 - 4 tcggctaatgcgtttccattatcaaatcgataagttttaccttacaacctt 22.6
fur U00096 710103 + 5 aaagttacaaatttgtagcaattattttgattggcattatctattaatacg 25.6
U00096 710103 - 6 cgtattaatagataatgccaatcaaaataattgctacaaatttgtaacttt 25.6
dps U00096 848228 + 7 ccgctattctggctgttcctatcacactaatagtggtaacaagcgtgaaaa 12.6
U00096 848228 - 8 ttttcacgcttgttaccactattagtgtgataggaacagccagaatagcgg 12.6
grxA U00096 890054 + 9 gctgaaagtaggtttaacctgttgcattaattgctaaaagctataactgtt 27.0
U00096 890054 - 10 aacagttatagcttttagcaattaatgcaacaggttaaacctactttcagc 27.0
flu U00096 2069355 + 11 gaataaaacgatcaatatctattttatcgatcgtttatatcgatcgataag 17.1
U00096 2069355 - 12 cttatcgatcgatataaacgatcgataaaatagatattgatcgttttattc 17.1
O16 U00096 2467337 + 13 taaattgaaaggtcatattgattcaattgatagctatgagtatataagttc 24.3
U00096 2467337 - 14 gaacttatatactcatagctatcaattgaatcaatatgacctttcaattta 24.3
trxC U00096 2716640 + 15 tcgtaccaaagcctgcgactatcatacctattgaataaaacagattgttgt 13.2
U00096 2716640 - 16 acaacaatctgttttattcaataggtatgatagtcgcaggctttggtacga 13.2
gorA U00096 3643862 + 17 agctggatcgtgccggagtaattgcagccattgctggcacctattacgtct 6.5
U00096 3643862 - 18 agacgtaataggtgccagcaatggctgcaattactccggcacgatccagct 6.5
katG U00096 4131337 + 19 caatatgtaagatctcaactatcgcatccgtggattaattcaattataact 16.7
U00096 4131337 - 20 agttataattgaattaatccacggatgcgatagttgagatcttacatattg 16.7
oxyR U00096 4156029 + 21 agggataatcgttcattgctattctacctatcgccatgaactatcgtggcg 17.6
U00096 4156029 - 22 cgccacgatagttcatggcgataggtagaatagcaatgaacgattatccct 17.6
fhuF.1 U00096 4603273 + 23 ctaaatgataatgattgctaatcatagcgataggtttacccgatagcaagg 17.7
U00096 4603273 - 24 ccttgctatcgggtaaacctatcgctatgattagcaatcattatcatttag 17.7
fhuF.2 U00096 4603357 + 25 atatgatattggttatcattatcaatgaaagagatgaaatcatgttgcaac 16.9
U00096 4603357 - 26 gttgcaacatgatttcatctctttcattgataatgataaccaatatcatat 16.9
mu mom V01463 68 + 27 agaaaacgacgatcgaatcaattaaatcgatcggtaatacagatcgattat 20.0
V01463 68 - 28 ataatcgatctgtattaccgatcgatttaattgattcgatcgtcgttttct 20.0
(*
Karen: Here is the current inst.oxyr file. We should work with this one
because it is the only one upgraded to the E. coli chromosome. (I did that
recently.) To create the old model, remove the extra ones by commenting them
out and consult with me about the final list. You might also be able to
compare it to the models in ~toms/delila/*oxy*. Tom
---
*)
title "OxyR version = 2.16 of inst.oxyr 2000 June 27";
(* begin module numbering *)
(* number only the pieces, starting at 1 *)
default numbering piece;
default numbering 1;
default out-of-range reduce-range;
(* end module numbering *)
(* DDD marks sites that overlap a nearby proven site. *)
organism E.coli;
chromosome E.coli;
piece U00096; { the target sequence is 4639221 bases }
name "dsbG";
get from 637851 -200 to same +200 direction +;
get from 637851 +200 to same -200 direction -;
{ original source probe: }
{ name "ahpC"; piece D13187; get from 1 to 316 direction +; }
name "ahpC";
get from 638089 -200 to same +200 direction +;
get from 638089 +200 to same -200 direction -;
name "fur";
(* This is the site footprinted by Ming for the Jbact paper -
my original discovery! *)
get from 710103 -200 to same +200 direction +;
get from 710103 +200 to same -200 direction -;
{ original source probe: }
{ name "dps"; piece X69337; get from 401 to 1 direction -; }
name "dps";
get from 848228 -200 to same +200 direction +;
get from 848228 +200 to same -200 direction -;
{ original source probe: }
{ name "grxA"; piece M13449; get from 401 to 1 direction -; }
name "grxA";
get from 890054 -200 to same +200 direction +;
get from 890054 +200 to same -200 direction -;
name "flu"; (* from Ming Zheng *)
get from 2069355 -200 to same +200 direction +;
get from 2069355 +200 to same -200 direction -;
name "O16"; (* from Ming Zheng *)
get from 2467337 -200 to same +200 direction +;
get from 2467337 +200 to same -200 direction -;
name "trxC";
get from 2716640 -200 to same +200 direction +;
get from 2716640 +200 to same -200 direction -;
{ original source probe: }
{ name "gorA"; piece U00039; get from 120581 to 120981 direction +; }
name "gorA";
get from 3643862 -200 to same +200 direction +;
get from 3643862 +200 to same -200 direction -;
{ original source probe: }
{ name "katG"; piece M21516; get from 1 to 268 direction +; }
name "katG";
get from 4131337 -200 to same +200 direction +;
get from 4131337 +200 to same -200 direction -;
{ original source probe: }
{ name "oxyR"; piece J04553; get from 1 to 363 direction +; }
name "oxyR";
get from 4156029 -200 to same +200 direction +;
get from 4156029 +200 to same -200 direction -;
(******************************************************************************)
(* 1998 July 2 These are the new sites footprinted by Ming. yjjS = fhuF
Footprint data: 1999 Jan printout from Bernard Doan. *)
{}
(* 2000 June 19 predicted site, confirmed by footprinting according to Ming
Zhang *)
{}
name "fhuF.1"; (* high affinity, formerly yjjS.2 *)
get from 4603273 -200 to same +200 direction +;
get from 4603273 +200 to same -200 direction -;
{}
name "fhuF.2"; (* formerly yjjS.1 *)
get from 4603357 -200 to same +200 direction +;
get from 4603357 +200 to same -200 direction -;
{}
{
(* THIS SITE, formerly named fhuF.2 IS NOT PROVEN EXPERIMENTALLY, BUT IT
OVERLAPS fhuF.2 (formerly named fhuF.3) HOLD UNTIL PROVEN. DDD
Low affinity? 1999 June 1, Gigi: "The low affinity yjjS
site is 2-4 fold lower in affinity than the high affinity site.
2000 June 19: site is blocked by fhuF.1, which is stronger! *)
name "fhuF.3"; (* formerly fhuF.2 *)
get from 4603251 -200 to same +200 direction +;
get from 4603251 +200 to same -200 direction -;
}
(******************************************************************************)
{ E. coli SITES TO HOLD FOR NOW }
(* Salmonella orf *)
(*
This is the equivalent of dsbG in E. coli and so can be removed now.
organism extra.fragments;
chromosome extra.fragments;
piece sal.orf;
name "orf";
get from 29 -200 to 29 +200 direction +;
name "";
get from 29 +200 to 29 -200 direction -;
*)
{2000 June 21 Bernard was never able to get an OxyR footprint at ybaL
name "ybaL"; (* from Ming Zheng *)
get from 502543 -200 to same +200 direction +;
get from 502543 +200 to same -200 direction -;
}
{
name "R16 "; (* reduced, apparently *)
get from 645756 -200 to same +200 direction +;
get from 645756 +200 to same -200 direction -;
}
(******************************************************************************)
organism B.Mu;
chromosome B.Mu;
name "mu mom";
piece V01463; (* XXMU01 *);
get from 68 -200 to 68 +200 direction +;
get from 68 +200 to 68 -200 direction -;
(* this is not a proven site, but it overlaps the one at position 68
and is quite strong. DDD
name "mu mom 2";
get from 59 -200 to same +200 direction +;
get from 59 +200 to same -200 direction -;
*)
(******************************************************************************)
This page is at www.lecb.ncifcrf.gov/~lewiska/projects/fur/oxyr/2.html.
Page origin: 2000 August 11
Last updated: 2001 May 24
Karen A. Lewis