Back to main OxyR model comparison page
This is the original OxyR model, referred to as Model 1. It contains binding sites in the promoters of the following genes:
Below is the aligned listing and instruction file.
alist 6.25, aligned listing of book:
* 2000/08/15 11:31:46, 1999/05/04 14:41:13,
OxyR version = 2.22 of inst.oxyr.orf 2000 July 27
piece names from:
* 2000/08/15 11:31:46, 1999/05/04 14:41:13,
OxyR version = 2.22 of inst.oxyr.orf 2000 July 27
The alignment is by delila instructions
The book is from: -200 to 200
This alignment is from: -25 to 25
---------------- ++++++++++++++++
2222221111111111--------- +++++++++1111111111222222
543210987654321098765432101234567890123456789012345
................................................... bits
ahpC U00096 638089 + 1 aaggttgtaaggtaaaacttatcgatttgataatggaaacgcattagccga 19.5
U00096 638089 - 2 tcggctaatgcgtttccattatcaaatcgataagttttaccttacaacctt 19.5
dps U00096 848228 + 3 ccgctattctggctgttcctatcacactaatagtggtaacaagcgtgaaaa 12.3
U00096 848228 - 4 ttttcacgcttgttaccactattagtgtgataggaacagccagaatagcgg 12.3
grxA U00096 890054 + 5 gctgaaagtaggtttaacctgttgcattaattgctaaaagctataactgtt 26.0
U00096 890054 - 6 aacagttatagcttttagcaattaatgcaacaggttaaacctactttcagc 26.0
gorA U00096 3643862 + 7 agctggatcgtgccggagtaattgcagccattgctggcacctattacgtct 11.2
U00096 3643862 - 8 agacgtaataggtgccagcaatggctgcaattactccggcacgatccagct 11.2
katG U00096 4131337 + 9 caatatgtaagatctcaactatcgcatccgtggattaattcaattataact 19.1
U00096 4131337 - 10 agttataattgaattaatccacggatgcgatagttgagatcttacatattg 19.1
oxyR U00096 4156029 + 11 agggataatcgttcattgctattctacctatcgccatgaactatcgtggcg 13.9
U00096 4156029 - 12 cgccacgatagttcatggcgataggtagaatagcaatgaacgattatccct 13.9
orf sal.orf 29 + 13 tggcacgccagctcttacctatgtctgtgataggcatcatcattaatactc 17.6
sal.orf 29 - 14 gagtattaatgatgatgcctatcacagacataggtaagagctggcgtgcca 17.6
mu mom V01463 68 + 15 agaaaacgacgatcgaatcaattaaatcgatcggtaatacagatcgattat 19.4
V01463 68 - 16 ataatcgatctgtattaccgatcgatttaattgattcgatcgtcgttttct 19.4
mu mom 2 V01463 59 + 17 agcgcatatagaaaacgacgatcgaatcaattaaatcgatcggtaatacag 18.5
V01463 59 - 18 ctgtattaccgatcgatttaattgattcgatcgtcgttttctatatgcgct 18.5
title "OxyR version = 2.22 of inst.oxyr.orf 2000 July 27";
(* begin module numbering *)
(* number only the pieces, starting at 1 *)
default numbering piece;
default numbering 1;
default out-of-range reduce-range;
(* end module numbering *)
(* DDD marks sites that overlap a nearby proven site. *)
(* 2000 July 26: KAL altered inst to rebuild the OxyR model that originally
found fhuF and dsbG sites *)
organism E.coli;
chromosome E.coli;
piece U00096; { the target sequence is 4639221 bases }
{name "dsbG";
(* 2000 July 26: KAL removed from model to rebuild "old" OxyR model *)
(* 2000 July 27: KAL added to model again because dsbG is E. coli equivalent
of Salmonella orf *)
(* 2000 July 27: KAL removed from model to rebuild "very old" OxyR model *)
get from 637851 -200 to same +200 direction +;
get from 637851 +200 to same -200 direction -;}
{ original source probe: }
{ name "ahpC"; piece D13187; get from 1 to 316 direction +; }
name "ahpC";
get from 638089 -200 to same +200 direction +;
get from 638089 +200 to same -200 direction -;
{name "fur";
(* This is the site footprinted by Ming for the Jbact paper -
my original discovery! *)
(* 2000 July 26: KAL removed from model to rebuild "old" OxyR model *)
get from 710103 -200 to same +200 direction +;
get from 710103 +200 to same -200 direction -;}
{ original source probe: }
{ name "dps"; piece X69337; get from 401 to 1 direction -; }
name "dps";
get from 848228 -200 to same +200 direction +;
get from 848228 +200 to same -200 direction -;
{ original source probe: }
{ name "grxA"; piece M13449; get from 401 to 1 direction -; }
name "grxA";
get from 890054 -200 to same +200 direction +;
get from 890054 +200 to same -200 direction -;
{name "flu"; (* from Ming Zheng *)
(* 2000 July 26: KAL removed from model to rebuild "old" OxyR model *)
get from 2069355 -200 to same +200 direction +;
get from 2069355 +200 to same -200 direction -;}
{name "O16"; (* from Ming Zheng *)
(* 2000 July 26: KAL removed from model to rebuild "old" OxyR model *)
get from 2467337 -200 to same +200 direction +;
get from 2467337 +200 to same -200 direction -;}
{name "trxC";
get from 2716640 -200 to same +200 direction +;
get from 2716640 +200 to same -200 direction -;}
{ original source probe: }
{ name "gorA"; piece U00039; get from 120581 to 120981 direction +; }
name "gorA";
get from 3643862 -200 to same +200 direction +;
get from 3643862 +200 to same -200 direction -;
{ original source probe: }
{ name "katG"; piece M21516; get from 1 to 268 direction +; }
name "katG";
get from 4131337 -200 to same +200 direction +;
get from 4131337 +200 to same -200 direction -;
{ original source probe: }
{ name "oxyR"; piece J04553; get from 1 to 363 direction +; }
name "oxyR";
get from 4156029 -200 to same +200 direction +;
get from 4156029 +200 to same -200 direction -;
(******************************************************************************)
(* 1998 July 2 These are the new sites footprinted by Ming. yjjS = fhuF
Footprint data: 1999 Jan printout from Bernard Doan. *)
{}
(* 2000 June 19 predicted site, confirmed by footprinting according to Ming
Zhang *)
(* 2000 July 26 : KAL removed from model to rebuild "old" OxyR model *)
{
name "fhuF.1"; (* high affinity, formerly yjjS.2 *)
get from 4603273 -200 to same +200 direction +;
get from 4603273 +200 to same -200 direction -;}
{
name "fhuF.2"; (* formerly yjjS.1 *)
get from 4603357 -200 to same +200 direction +;
get from 4603357 +200 to same -200 direction -;}
{}
{
(* THIS SITE, formerly named fhuF.2 IS NOT PROVEN EXPERIMENTALLY, BUT IT
OVERLAPS fhuF.2 (formerly named fhuF.3) HOLD UNTIL PROVEN. DDD
Low affinity? 1999 June 1, Gigi: "The low affinity yjjS
site is 2-4 fold lower in affinity than the high affinity site.
2000 June 19: site is blocked by fhuF.1, which is stronger! *)
name "fhuF.3"; (* formerly fhuF.2 *)
get from 4603251 -200 to same +200 direction +;
get from 4603251 +200 to same -200 direction -;
}
(******************************************************************************)
{ E. coli SITES TO HOLD FOR NOW }
(* Salmonella orf *)
{
This is the equivalent of dsbG in E. coli and so can be removed now.
(* 2000 July 27: KAL removed from rebuilding of old model because of
equivalence to dsbG in E. coli. *)
(* 2000 July 27: KAL added back into model to try to rebuild "very old"
model *)}
organism extra.fragments;
chromosome extra.fragments;
piece sal.orf;
name "orf";
get from 29 -200 to 29 +200 direction +;
name "";
get from 29 +200 to 29 -200 direction -;
{2000 June 21 Bernard was never able to get an OxyR footprint at ybaL
name "ybaL"; (* from Ming Zheng *)
get from 502543 -200 to same +200 direction +;
get from 502543 +200 to same -200 direction -;
}
{
name "R16 "; (* reduced, apparently *)
get from 645756 -200 to same +200 direction +;
get from 645756 +200 to same -200 direction -;
}
(******************************************************************************)
organism B.Mu;
chromosome B.Mu;
name "mu mom";
piece V01463; (* XXMU01 *);
get from 68 -200 to 68 +200 direction +;
get from 68 +200 to 68 -200 direction -;
(* this is not a proven site, but it overlaps the one at position 68
and is quite strong. DDD
2000 July 26: KAL added back into model to rebuild "old" OxyR model *)
name "mu mom 2";
get from 59 -200 to same +200 direction +;
get from 59 +200 to same -200 direction -;
(******************************************************************************)
This page is at www.lecb.ncifcrf.gov/~lewiska/projects/fur/oxyr/1.html.
Page origin: 2000 August 11
Last updated: 2001 May 24
Karen A. Lewis